Mutations Changes to DNA

Mutations Changes to DNA are called mutations – change the DNA – changes the mRNA – may change protein – may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

Types of mutations Changes to the letters (A,C,T,G bases) in the DNA – point mutation change to ONE letter (base) in the DNA may cause change to protein, may not – frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

Point Mutations One base change – can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR Does this change the sentence? A LITTLE!

Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop Does this change the protein? DEPENDS…

Sickle Cell Disease Symptoms Anemia Pain Frequent infections Delayed growth Stroke Pulmonary hypertension Organ damage Blindness Jaundice gallstones Life expectancy 42 in males 48 in females Caused by a genetic defect Carried by 5% of humans Carried by up to 25% in some regions of Africa

Sickle cell anemia Hemoglobin protein in red blood cells – strikes 1 out of 400 African Americans – limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? Why not? The code has repeats in it!

Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop Really destroyed that protein!

Frameshift Mutations Add or delete one or more bases – changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!

Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA Does this change the protein? A LOT!

Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA Does this change the protein? A LOT!

Cystic fibrosis Broken salt channel in cells – strikes 1 in 2500 white births – gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function – without treatment children die before 5; with treatment can live past their late 20s

Effect on Lungs Salt channel transports salt through protein channel out of cell Osmosis problems! airway salt H2OH2O H2OH2O normal lungs cystic fibrosis cells lining lungs salt channel normal mucus thick mucus mucus & bacteria build up = lung infections & damage 

Deletion leads to Cystic fibrosis deletion Loss of one amino acid!