1. Warm up: 01/8/2013 1.Mendel hypothesized that reproductive cells have only one factor for each inherited trait. This hypothesis is supported by the observation that: Copy out the question and underline the key word Copy out the question and underline the key word A. haploid cells are produced by mitosis B. diploid cells are produced by mitosis C. haploid cells are produced by meiosis D. diploid cells are produced by meiosis

2. GENETICS OBJECTIVES: Predict the outcomes of various genetic combinations as monohybrid, dihybrid crosses and non- Mendelian inheritance by writing and active listening.

3. The Work of Gregor Mendel: Monohybrid, Monohybrid,Dihybrid, Incomplete, Incomplete, Codominance Codominance Multiple Alleles, Multiple Alleles, Polygenic Traits Polygenic Traits

4. Gregor Mendel’s Peas:  Mendel is the father of genetics.  Studied peas.

5. Mendel’s Laws of Heredity Why we look the way we look...

6. What is heredity? The passing on of characteristics (traits) from parents to offspring. Genetics is the study of heredity

7. Mendel crossed 2 different true –breeding pea plants (all homozygous: TT X TT) OR (tt x tt) Mendel crossed 2 different true –breeding pea plants (all homozygous: TT X TT) OR (tt x tt) Mendel called the original pair of crossed plants parental generation ( p ) Mendel called the original pair of crossed plants parental generation ( p ) The first offspring were called F1 or first filial generation The first offspring were called F1 or first filial generation The offspring of crosses between parents with different traits(white & black parents) are called hybrids The offspring of crosses between parents with different traits(white & black parents) are called hybrids

8. F1 generation He called the offspring, F1 or first filial generation Filius and filia are the Latin words for “son” and “daughter” Filius and filia are the Latin words for “son” and “daughter” Therefore the child in the picture below is the F1 generation of those parents Therefore the child in the picture below is the F1 generation of those parents Parental generation ( P) First filial generatiom ( F1 )

9. True- Breeding Pure genes, if allowed to self pollinate, these plants would produce identical copies of themselves. Alleles : AA & AA for the dogs (all dogs have AA alleles) Alleles : g g and g g for green peas (all green peas have g g alleles)

10. cross pollination Basis of Mendel’s Experiments: Tall, Short, green Seeds, yellow seeds Basis of Mendel’s Experiments: Tall, Short, green Seeds, yellow seeds What accounts for the green pea seed in the f2 generation Because 1 out of 4 offspring of heterozygous parents will be homozygous recessive? Why would all of the f1 generation have yellow phenotypes? Because yellow is dominant over green

11. TSW compare and contrast dominant and recessive alleles; define & predict the outcome of genetic crosses using Punnet squares. Objectives:01/09/2013

12. First Conclusion: Biological inheritance is determined by factors that are passed from one generation to the next Biological inheritance is determined by factors that are passed from one generation to the next Today, we called these GENES Today, we called these GENES Different form of a Genes are called Alleles Different form of a Genes are called Alleles

13. Mendel used peas... They reproduce sexually They reproduce sexually They have two distinct, They have two distinct, male and female, sex cells called gametes (sperm & egg) Their traits are easy to isolate Their traits are easy to isolate

14. Mendel crossed them Fertilization - the uniting of male and female gametes. Fertilization - the uniting of male and female gametes. Cross - combining gametes (sperm & egg) from parents with different traits.

15. Questions What did Mendel cross? What did Mendel cross? What are traits? What are traits? What are gametes? What are gametes? What is fertilization? What is fertilization? What is heredity? What is heredity? What is genetics? What is genetics?

16. What Did Mendel Find? He discovered different laws and rules that explain factors affecting heredity. He discovered different laws and rules that explain factors affecting heredity.

17. Rule of Unit Factors Each organism has two alleles for each trait Each organism has two alleles for each trait Example: T T for tallness Example: T T for tallness Alleles - different forms of the same gene Alleles - different forms of the same gene BB Bb AA Aa Dd BB Bb AA Aa Dd Genes - located on chromosomes, they control how an organism develops Genes - located on chromosomes, they control how an organism develops

18. Rule of Dominance Dominant Alleles- Represented by capital letter. The trait that is observed in the offspring is the dominant trait Examples: TT Tt SS Ss DD Dd Examples: TT Tt SS Ss DD Dd Recessive Alleles- Represented by lower case letter. The trait that disappears in the offspring is the recessive trait. The trait that disappears in the offspring is the recessive trait. Examples: tt ss dd aa

19. Second conclusion: Principle of Dominance Principle of Dominant: states that some alleles are dominant and others are recessive Principle of Dominant: states that some alleles are dominant and others are recessive An organism with a dominant form will ALWAYS show the trait An organism with a dominant form will ALWAYS show the trait

20. Law of Segregation The two alleles for a trait must separate when gametes are formed. The two alleles for a trait must separate when gametes are formed. Mendel's principle of independent assortment states that, for any particular trait, the pair of alleles of each parent separate and only one allele from each parent passes to an offspring.

21. Genes and Dominance : Mendel studied 7 different pea plant traits Mendel studied 7 different pea plant traits Trait: a specific characteristic, such as seed color or height Trait: a specific characteristic, such as seed color or height 1.1.1.1. Form of ripe seed SmoothWrinkled 2.2.2.2. Color of seed albumen YellowGreen 3.3.3.3. Color of seed coat GreyWhite 4.4.4.4. Form of ripe pods InflatedConstricted 5.5.5.5. Color of unripe pods GreenYellow 6.6.6.6. Position of flowers AxialTerminal 7.7.7.7. Length of stem TallDwarf

22. Law of Independent Assortment The genes for different traits are inherited independently of each other. The genes for different traits are inherited independently of each other. This help account for many genetic variations observed in plants,animals and other organisms. This help account for many genetic variations observed in plants,animals and other organisms.

23. Questions... How many alleles are there for each trait? How many alleles are there for each trait? What is an allele? What is an allele? How many alleles does a parent pass on to each offspring for each trait How many alleles does a parent pass on to each offspring for each trait

24. Phenotype & Genotype Phenotype - the way an organism looks (physical appearance) Phenotype - the way an organism looks (physical appearance) red hair or brown hair red hair or brown hair genotype - the genetic make up of an organism (The letters or alleles of that traits) genotype - the genetic make up of an organism (The letters or alleles of that traits) AA or Aa or aa AA or Aa or aa

25. Two important terms... Phenotype: The outlook of an organism or physical appearance Genotype: The genetic information written in DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTC C CACTTTCAAGCTCGGCCCCT T TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG GCCAAGAATGGCTCCCACC T GGCTCTCAGACATTCCCCT GGTCCAACCCCCAGGCCAT CAAGATGTCTCAGAGAGGC GGCTAGACACCCAGAGACC TCAAGTGACCATGTGGGAA CGGGATGTTTCCAGTGACA GGCA Genotype Phenotypes Genotype

26. Questions... What do we call the trait that is observed? What do we call the trait that is observed? What case (upper or lower) is it written in? What case (upper or lower) is it written in? What about the one that disappears? What about the one that disappears? What case is it written in? What case is it written in?

27. Objectives: 1/10/13 TSW predict the outcome of independent assortment using a dihybrid cross; define the term independent assortment. TSW predict the outcome of independent assortment using a dihybrid cross; define the term independent assortment.

28. Heterozygous & Homozygous Heterozygous - if the two alleles for a trait are different (Aa) Heterozygous - if the two alleles for a trait are different (Aa) 2 different alleles (T t) considered Hybrids 2 different alleles (T t) considered Hybrids Homozygous - if the two alleles for a trait are the same (AA or aa). Homozygous - if the two alleles for a trait are the same (AA or aa).

29. Monohybrid Monohybrid Monohybrid Cross - crossing parents who differ in only one trait (AA with aa) Monohybrid Cross - crossing parents who differ in only one trait (AA with aa)

30. Steps for Solving a Genetics Problem: Trait – dominant = A ( AA or Aa ) Trait – recessive = a ( aa ) Trait – dominant = A ( AA or Aa ) Trait – recessive = a ( aa ) ___________ x ___________ ___________ x ___________ Punnett Square Punnett Square Answer questions based on results from Punnett Square Answer questions based on results from Punnett Square ________ ____ ____

31. Questions... What is the phenotype? What is the phenotype? What is the genotype? What is the genotype? What is homozygous? What is homozygous? What is heterozygous? What is heterozygous? What is monohybrid crossing? What is monohybrid crossing?

32. Very important terms to know! Homozygous : 2 identical alleles (TT or tt) considered true-breeding Homozygous : 2 identical alleles (TT or tt) considered true-breeding Heterozygous : 2 different alleles (Tt) considered Hybrids Heterozygous : 2 different alleles (Tt) considered Hybrids Phenotypes : physical appearance, like tall or short Phenotypes : physical appearance, like tall or short Genotypes : genetic make up like TT, Tt, or tt Genotypes : genetic make up like TT, Tt, or tt

34. Genetics and Probability: Probability: the likelihood that an event will occur. Probability: the likelihood that an event will occur. Coin toss: 2 possibilities: head or tails Coin toss: 2 possibilities: head or tails The probability or chances are equal, 1 in 2 chance The probability or chances are equal, 1 in 2 chance That is ½ or 50% chance That is ½ or 50% chance

35. Objectives: 01/14/2013 TSW predict the outcome of independent assortment using a dihybrid cross; define the term independent assortment. TSW predict the outcome of independent assortment using a dihybrid cross; define the term independent assortment.

36. Dihybrid Dihybrid Cross - crossing parents who differ in two traits (TTBB with ttbb) Dihybrid Cross - crossing parents who differ in two traits (TTBB with ttbb)

37. Dihybrid Cross Mendel’s next experiment: Mendel’s next experiment: After test crosses with one trait, Mendel decided to test cross plants with two traits. After test crosses with one trait, Mendel decided to test cross plants with two traits. Example: Tall and black (TT BB) Vs. Short and white ( t t bb)

38. A cross between two heterozygous tall black parents (Tt Bb) TB TbtB tb Tb tB tb

39. Ratio of phenotype Tall and black: Tall and black: Tall and white: Tall and white: Short and black: Short and black: Short and white: Short and white: A phenotypic ratio of A phenotypic ratio of

40. Objectives: 01/16/2013 TSW take short vocabulary quiz on genetics on what they have covered throughout the week to show mastery of material. -Continue with interactive Cornell notes on Incomplete & Co dominance.

41. Summary of Mendel’s Principles: Inheritance of biological characteristics is determined by genes passed from parents to offspring Inheritance of biological characteristics is determined by genes passed from parents to offspring In cases where 2 alleles exist: 1 is dominant, 1 is recessive In cases where 2 alleles exist: 1 is dominant, 1 is recessive Each adult has 2 copies of each gene, one from each parent Each adult has 2 copies of each gene, one from each parent Genes for different things usually segregate independently Genes for different things usually segregate independently

42. Incomplete Dominance Incomplete Dominance X Homozygous parent Homozygous parent All F 1 are heterozygous X F 2 shows three phenotypes in 1:2:1 ratio IncompleteDominance

43. Incomplete Dominant Some traits are neither dominant nor recessive and many traits are controlled by multiple alleles or multiple genes. Some traits are neither dominant nor recessive and many traits are controlled by multiple alleles or multiple genes. Incomplete Dominant: the case in which one allele is not completely dominant over the other. Incomplete Dominant: the case in which one allele is not completely dominant over the other. A red and a white flower when crossed gives rise to a pink flower. Neither the red nor the white flower is completely dominant over other.

44. Codominance Codominance: is a case where both alleles contribute to the phenotype. Codominance: is a case where both alleles contribute to the phenotype. The allele for black feathers is codominant with the allele for white feathers. The allele for black feathers is codominant with the allele for white feathers.

45. Codominance: ABO Blood Types Gene that controls ABO type codes for enzyme that dictates structure of a glycoprotein on blood cells Gene that controls ABO type codes for enzyme that dictates structure of a glycoprotein on blood cells Two alleles (A and B) are codominant when paired Two alleles (A and B) are codominant when paired Third allele (O) is recessive to others Third allele (O) is recessive to others A heterozygous blood group B marries a heterozygous blood group A woman. Using the punnett Square below show the offsprings of this marriage.

46. Codominance (ABO) blood group A homozygous blood group (O) man marries a heterozygous blood group (AB) woman. Using the punnett Square below show the offsprings of this marriage A homozygous blood group (O) man marries a heterozygous blood group (AB) woman. Using the punnett Square below show the offsprings of this marriage

47. Multiple Alleles Multiple Alleles: It is a situation where genes have more than two alleles for a particular trait. Ex coat color and albino Polygenic traits ; Traits that are controlled by two or more genes. Ex: skin color is controlled by 4 different genes. eye color eye color Coat color for rabbit Albino

48. Sex Linked Genes These are genes located on sex chromosome. Example: Color –blindness, Hemophilia & Duchene muscular. A heterozygous color blind woman marries a color blind man. Draw a punnett Square the genetic cross A woman with hemophilia marries a non hemophilic man. Draw a Punnett Square the genetic cross.

49. Sex Linked Genes Non-disjunction : Failure of chromosomes to separate. Down syndrome –Trisomy 21; a person with 3 copies of chromosome 21. Turner’s syndrome: one x chromosome for females. Klinefelter’s Syndrome: XXY, XXXY, XXXXY

50. Pedigree Chart A chart that shows relationships within a family. A chart that shows relationships within a family. Geneticists use these to analyze the genotypes of family members. Geneticists use these to analyze the genotypes of family members.

51. Symbols used in pedigree charts Normal male Normal male Affected male Affected male Normal female Normal female Affected female Affected female Marriage Marriage A marriage with five children, two daughters and three sons. The eldest son is affected by the condition. Eldest child  Youngest child © 2007 Paul Billiet ODWSODWS

52. Could this trait be autosomal recessive? YES

53. Could this trait be autosomal dominant? NO If the trait were an autosomal dominant, the affected child would have to have an affected parent who could pass the trait down to the child.

54. Could this trait be autosomal recessive? NO The parents would have to be homozygous (aa) and could only produce homozygous, affected children. This pedigree contains two, unaffected children.

55. I II 12 1 2 3 4 5 RECESSIVE TRAIT: (A-) unaffected and (aa) affected What is the genotype of the mother? What is the genotype of the father? What are the genotypes of the children?

56. I II 1 2 1 2 3 4 5 RECESSIVE TRAIT: (A-) unaffected and (aa) affected What is the genotype of the mother? What is the genotype of the father? What are the genotypes of the children ?

57. I II 1 2 3 4 5 6 7 DOMINANT TRAIT: (A-) affected and (aa) unaffected Mother’s genotype: Aa Father’s genotype: aa Aa, aa, Aa, Aa, aa Aa aa Aa aa