1. © 2010 Pearson Education, Inc. Lectures by Chris C. Romero, updated by Edward J. Zalisko PowerPoint ® Lectures for Campbell Essential Biology, Fourth Edition – Eric Simon, Jane Reece, and Jean Dickey Campbell Essential Biology with Physiology, Third Edition – Eric Simon, Jane Reece, and Jean Dickey Chapter 11 How Genes Are Controlled

2. © 2010 Pearson Education, Inc. Lectures by Chris C. Romero, updated by Edward J. Zalisko PowerPoint ® Lectures for Campbell Essential Biology, Fourth Edition – Eric Simon, Jane Reece, and Jean Dickey Campbell Essential Biology with Physiology, Third Edition – Eric Simon, Jane Reece, and Jean Dickey Chapter 12 DNA Technology

3. © 2010 Pearson Education, Inc.  How can Mutations affect different generations?  1- I take a new experimental pill that changes the DNA in my skin cells to make me permanently tan.  2- I go to gym to get huge muscles.  3- I smoke cigarettes and get lung cancer.  4- I expose myself to gamma rays to become the Hulk.

4. © 2010 Pearson Education, Inc.  The human gene for insulin is inserted into bacteria  Because the genetic code is universal, the human gene can be transcribed and translated by the bacteria, thereby creating large amounts of insulin. Transformation Insulin producing Bacteria Bacteria l DNA Human Insulin Gene ENZYME

5. © 2010 Pearson Education, Inc. An Example of Selective Breeding Brahman cattle: Good resistance to heat but poor beef. English shorthorn cattle: Good beef but poor heat resistance. Santa Gertrudis cattle: Formed by crossing Brahman and English shorthorns; has good heat resistance and beef.

6. © 2010 Pearson Education, Inc. Cell division in culture Root cells in growth medium Root of carrot plant Single cell Figure 11.12-3 Plant Clones

7. © 2010 Pearson Education, Inc. Young plant Cell division in culture Root cells in growth medium Root of carrot plant Single cell Figure 11.12-4

8. © 2010 Pearson Education, Inc. Adult plant Young plant Cell division in culture Root cells in growth medium Root of carrot plant Single cell Figure 11.12-5

9. © 2010 Pearson Education, Inc. The somatic cells of a single plant can be used to produce hundreds of thousands of clones. Plant cloning –Demonstrates that cell differentiation in plants does not cause irreversible changes in the DNA –Is now used extensively in agriculture

10. © 2010 Pearson Education, Inc. Reproductive Cloning of Animals Nuclear transplantation –Involves replacing nuclei of egg cells with nuclei from differentiated cells –Has been used to clone a variety of animals –Success/Efficiency rate NOT good

11. © 2010 Pearson Education, Inc. In 1997, Scottish researchers produced Dolly, a sheep, by replacing the nucleus of an egg cell with the nucleus of an adult somatic cell in a procedure called reproductive cloning, because it results in the birth of a new animal.

12. © 2010 Pearson Education, Inc. Remove nucleus from egg cell Figure 11.13-1

13. © 2010 Pearson Education, Inc. Donor cell Remove nucleus from egg cell Add somatic cell from adult donor Figure 11.13-2

14. © 2010 Pearson Education, Inc. Donor cell Nucleus from donor cell Remove nucleus from egg cell Add somatic cell from adult donor Grow in culture to produce an early embryo Figure 11.13-3

15. © 2010 Pearson Education, Inc. Donor cell Nucleus from donor cell Remove nucleus from egg cell Add somatic cell from adult donor Grow in culture to produce an early embryo Implant embryo in surrogate mother Clone of donor is born Reproductive cloning Figure 11.13-4

16. © 2010 Pearson Education, Inc.

17. Figure 11.13a

18. © 2010 Pearson Education, Inc. Human Cloning Cloning of animals –Has heightened speculation about human cloning –Is very difficult and inefficient Critics raise practical and ethical objections to human cloning.

19. © 2010 Pearson Education, Inc. Cloning Pros:  There is no better way to understand the human genome  Ability to produce “superhumans”  Will all but cease the production of lab animals  Medicinal methods will be thrusted into a new era  Further understanding of our past (evolution)  Organ transplant waiting lists will be no more

20. © 2010 Pearson Education, Inc. Cloning Cons:  Humans are sentient beings, they are not made to be specimens. They are of free will  Ability to produce “Superhumans”  Countries could clone armies  If humans can be cloned, it makes them property, which can be sold. Inhumane  If cloning is relied upon for reproduction and we lose the ability to clone, everyone will have the same genotype and to reproduce would be a sick twist of inbreeding.  If everyone has the same genotype, a disease that is fatal for that genotype wipes out the human race

21. © 2010 Pearson Education, Inc.  Cloning does NOT take into account environmental traits or factors.

22. © 2010 Pearson Education, Inc. The expression of some genotypes depends on specific environments. Himalayan Rabbit

23. © 2010 Pearson Education, Inc. Gel Electrophoresis  Gel electrophoresis is a technique used to separate DNA into genes based on physical characteristics such as size.

24. © 2010 Pearson Education, Inc. Restriction Enzyme  Cuts DNA at specific sites—depending on enzyme.  EcoR1 cuts DNA GAATTC  PovII cuts DNA CAGCTG  SmaI cuts DNA CCCGGG  StuI cuts DNA AGGCCT  Alul cuts DNA AGCT

25. © 2010 Pearson Education, Inc. Use Enzyme Fournier1 which cuts CCGG ATCGTCGAACTGGGATCCGGTAAAGCTTTAAGGCCTTA CGTTCCGGGAAGGTTCCGGATTAAGGCCTTAAGGTT TCCGATCGATCGATTCGATCCGGATATCGGTAATTCG AATTCGTGTCATCGTTACGCTTGCCGGAATTTCCGTA TCGCCGGTTAATCTGAGACTACGGAGCATCGTAGTC Segments are 18, 26, 11, 40, 41, 17 and 31. So, in order, you get banding at: 11, 17, 18, 26, 31, 40, 41

26. © 2010 Pearson Education, Inc. Mixture of DNA fragments of different sizes Power source Gel Completed gel Band of longest (slowest) fragments Band of shortest (fastest) fragments Figure 12.17-3

27. © 2010 Pearson Education, Inc.

29. Organisms altered by genetic engineering. -genetic material changed by other than random natural breeding. -gene transfer-moving a gene from one organism to another. -these require skill and knowledge to be carried out properly GMO- genetically modified organism

30. © 2010 Pearson Education, Inc. Agriculture -food processors affected by genetic engineering. -shelf-life, storage, food-handling; extended and simplified. -help resist spoilage. -plants transformed-insect,disease, and herbicide resistant. -animals treated engineered hormones- produce more milk, leaner meat.

31. © 2010 Pearson Education, Inc.

33. Advocates of a cautious approach are concerned that: –Crops carrying genes from other species might harm the environment –GM foods could be hazardous to human health –Transgenic plants might pass their genes to close relatives in nearby wild areas

34. © 2010 Pearson Education, Inc. In 2000, negotiators from 130 countries (including the United States) agreed on a Biosafety Protocol that: –Requires exporters to identify GM organisms present in bulk food shipments

35. © 2010 Pearson Education, Inc. Genetic Ethics  Solving Crimes  Increase/Make better crops & food  Increased info : health, admittance  Cloning

36. © 2010 Pearson Education, Inc. Medicinal Studies  Control Group  Comparative results  Cost  Ethics  Help 1 now or Save all later?

37. © 2010 Pearson Education, Inc. SCID is a fatal inherited disease caused by a single defective gene that prevents the development of the immune system. SCID patients quickly die unless treated with: –A bone marrow transplant or –Gene therapy Since the year 2000, gene therapy has: –Cured 22 children with inborn SCID but –Unfortunately, caused four of the patients to develop leukemia, killing one of these children

38. © 2010 Pearson Education, Inc. Ethical Questions Raised by DNA Technology DNA technology raises legal and ethical questions—few of which have clear answers. –Should genetically engineered human growth hormone be used to stimulate growth in HGH-deficient children? –Do we have any right to alter an organism’s genes—or to create new organisms? –Should we try to eliminate genetic defects in our children and their descendants? –Should people use mail-in kits that can tell healthy people their relative risk of developing various diseases?

39. © 2010 Pearson Education, Inc. Donor cell Nucleus from donor cell Remove nucleus from egg cell Add somatic cell from adult donor Grow in culture to produce an early embryo Remove embryonic stem cells from embryo and grow in culture Induce stem cells to form specialized cells for therapeutic use Implant embryo in surrogate mother Clone of donor is born Reproductive cloning Therapeutic cloning Figure 11.13-5

40. © 2010 Pearson Education, Inc.

42. Embryonic Stem Cells Embryonic stem cells (ES cells) –Are derived from blastocysts –Can give rise to specific types of differentiated cells

43. © 2010 Pearson Education, Inc. Adult stem cells –Are cells in adult tissues –Generate replacements for nondividing differentiated cells Unlike embryonic ES cells, adult stem cells –Are partway along the road to differentiation –Usually give rise to only a few related types of specialized cells Adult Stem Cells

44. Adult stem cells in bone marrow Cultured embryonic stem cells Different culture conditions Different types of differentiated cells Heart muscle cells Nerve cells Blood cells Figure 11.15