1. Biotechnology Pre-AP Biology Ch.12 Ms. Haut

2. DNA technology has many useful applications –The Human Genome Project –The production of vaccines, cancer drugs, and pesticides –Engineered bacteria that can clean up toxic wastes Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

3. DNA and Crime Scene Investigations –Many violent crimes go unsolved For lack of enough evidence –If biological fluids are left at a crime scene DNA can be isolated from them

4. –DNA fingerprinting is a set of laboratory procedures That determines with near certainty whether two samples of DNA are from the same individual That has provided a powerful tool for crime scene investigators Investigator at one of the crime scenes (above), Narborough, England (left)

5. BACTERIAL PLASMIDS AND GENE CLONING Plasmids are used to customize bacteria: An overview –Gene cloning is one application of DNA technology Methods for studying and manipulating genetic material

6. The Bacterial Chromosome One double-stranded, circular molecule of DNA Located in nucleoid region, so transcription and translation can occur simultaneously Many also contain extrachromosomal DNA in plasmids

7. Binary Fission

8. Plasmids Short, circular DNA molecules outside the chromosome Carry genes that are beneficial but not essential Replicate independently of chromosome en.wikipedia.org/?title=Plasmid

9. R Plasmids Contain genes that confer antibiotic resistance Medical consequences: resistant strains of pathogens due to overuse of antibiotics http://www.slic2.wsu.edu:82/hurlbert/micro101/images/AntibioticSelection.gif

10. Bacteria as Tools Bacterial Transformation— –Uptake of DNA from the fluid surrounding the cell –Causes genetic recombination

11. Transformation Biotech companies use this technique to artificially introduce foreign genes into bacterial genomes (human insulin, human growth hormone)

12. –Researchers can insert desired genes into plasmids, creating recombinant DNA And insert those plasmids into bacteria (transformation) Figure 12.1

13. –If the recombinant bacteria multiply into a clone The foreign genes are also copied Isolate DNA from two sources 1 E. coli Cut both DNAs with the same restriction enzyme 2 Plasmid Human cell DNA Gene V Sticky ends Mix the DNAs; they join by base-pairing 3 Add DNA ligase to bond the DNA covalently 4 Recombinant DNA plasmid Gene V Put plasmid into bacterium by transformation 5 Clone the bacterium 6 Bacterial clone carrying many copies of the human gene

14. Restriction Enzymes Used to “cut and paste” DNA The tools used to make recombinant DNA are –Restriction enzymes, which cut DNA at specific sequences –DNA ligase, which “pastes” DNA fragments together

15. http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/bx15_01.jpg

16. Genes can be cloned in recombinant plasmids: A closer look –Bacteria take the recombinant plasmids from their surroundings –And reproduce, thereby cloning the plasmids and the genes they carry

17. Cloned genes can be stored in genomic libraries Genomic libraries, sets of DNA fragments containing all of an organism’s genes –Can be constructed and stored in cloned bacterial plasmids or phages Figure 12.4

18. Nucleic acid probes A short, single- stranded molecule of radioactively labeled or fluorescently labeled DNA or RNA –Can tag a desired gene in a library

19. CONNECTION Recombinant cells and organisms can mass- produce gene products –Applications of gene cloning include The mass production of gene products for medical and other uses Table 12.6

20. New genetic varieties of animals and plants are being produced –A plant with a new trait can be created using the Ti plasmid Genetically modified organisms are transforming agriculture

21. Biotech companies can artificially induce transformation of bacteria

22. “Golden rice” has been genetically modified to contain beta-carotene –This rice could help prevent vitamin A deficiency Figure 12.18B

23. Drought resistant corn Flavr Savr Tomato (CalGene)

24. Transgenic organisms –Are those that have had genes from other organisms inserted into their genomes –Different organisms, including bacteria, yeast, and mammals Can be used for this purpose Figure 12.6 These sheep carry a gene for a human blood protein that is a potential treatment for cystic fibrosis

25. DNA technology is changing the pharmaceutical industry –DNA technology Is widely used to produce medicines and to diagnose diseases CONNECTION

26. Hormones, cancer-fighting drugs, and new vaccines are being produced using DNA technology –This lab equipment is used to produce a vaccine against hepatitis B DNA technology is changing the pharmaceutical industry and medicine Figure 12.17

27. Therapeutic hormones –In 1982, humulin, human insulin produced by bacteria Became the first recombinant drug approved by the Food and Drug Administration Figure 12.7A

28. Diagnosis and Treatment of Disease –DNA technology Is being used increasingly in disease diagnosis Vaccines –DNA technology Is also helping medical researchers develop vaccines Figure 12.7B

30. DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec Jeffreys

31. First Forensic Use First used by law enforcement in England in the mid- 1980’s. DNA evidence exonerated one man, and convicted another. Described in The Blooding, by Joseph Wambaugh

32. How does it work? 99.9% of your DNA is the same as everyone else’s. The 0.1% that differs are a combination of: –Gene differences (Differences in the genes themselves) –Differences in “polymorphic regions” between the genes on the DNA.

33. How does it work? Certain points between the genes on the DNA have repeating base sequences. –For example: ATTACGCGCGCGCGCGCGCTAGC –These are called short tandem repeats (STRs for short)

34. How does it work? Everyone has STRs at the same place in their DNA, but they are different lengths for different people. –For example: Person 1: ATTACGCGCGCGCGCGCGTAGC (7 repeats) Person 2: ATTACGCGCGCGCGTAGC (5 repeats)

35. To Make a DNA Fingerprint… First, we use restriction enzymes to chop the DNA up into millions of fragments of various lengths. –Some of the fragments contain STRs; some do not. The ones that do are different lengths for different people.

36. Restriction Fragment Length Polymorphisms (RFLPs) Polymorphisms are slight differences in DNA sequences as seen in individuals of the same species

37. To Make a DNA Fingerprint… Next, we use gel electrophoresis to sort the DNA fragments by size.

38. Gel Electrophoresis Method for sorting proteins or nucleic acids on the basis of their electric charge and size

39. Gel Electrophoresis Electrical current carries negatively- charged DNA through gel towards positive electrode Agarose gel sieves DNA fragments according to size – Small fragments move farther than large fragments

40. Gel Electrophoresis

41. To Make a DNA Fingerprint… Finally, a radioactive probe attaches to our STRs. Only the fragments with our STRs will show up on the gel. Figure 12.11C Restriction fragment preparation 1 Restriction fragments Gel electrophoresis 2 Blotting 3 Filter paper Probe Radioactive probe 4 Detection of radioactivity (autoradiography) 5 Film

42. To Make a DNA Fingerprint… Since STRS are different lengths in different people, this creates a DNA Fingerprint.

43. Two uses for DNA Fingerprints... Forensics DNA taken from crime scenes (blood, semen, hair, etc.) can be compared to the DNA of suspects. Real-life CSI!

44. Two uses for DNA Fingerprints... Forensics This is an example of a gel that might be used to convict a rape suspect. Compare the “Sperm DNA” to the “Suspect DNA.” Which suspect committed the rape?

45. Two uses for DNA Fingerprints... Paternity Testing Since all of our DNA markers came from either mommy or daddy, we can use DNA fingerprints to determine whether a child and alleged father are related…just like on Maury Povich!

46. Two uses for DNA Fingerprints... Look at the two “Child” markers on this gel. Can they both be matched up to either the mother or the “alleged father?” Yes. This is a “positive” test for paternity.

47. Two uses for DNA Fingerprints... How about this gel? Do both of the child’s markers match either the mother or the “alleged father.” No! The “alleged father” is not this child’s biological parent.

48. Interpreting DNA Fingerprints Which child is not related to the mother? Son 2 Which children are not related to the father? Daughter 2 and Son 2

49. Interpreting DNA Fingerprints A blood stain was found at a murder scene. The blood belongs to which of the seven possible suspects? Suspect 3

50. Interpreting DNA Fingerprints Who committed this sexual assault? Suspect 1

51. Interpreting DNA Fingerprints These DNA fingerprints are from a mother, a child, and two possible biological fathers. Which one is the daddy? 2 nd alleged father

52. Interpreting DNA Fingerprints Mother, father, and four children. Which child is from a different father? Child 2

53. Interpreting DNA Fingerprints These DNA fingerprints are from a rape case. Did the defendant commit this crime?

54. Interpreting DNA Fingerprints Four different sets of twins. Which sets are identical twins (identical twins have identical DNA)

55. The Polymerase Chain Reaction (PCR) The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules

56. Polymerase Chain Reaction (PCR) Quick method of cloning DNA in vitro (without using cells) Can be used to increase small amounts of DNA for analysis

58. Figure 12.15 GENOMICS CONNECTION The Human Genome Project is an ambitious application of DNA technology –The Human Genome Project, begun in 1990 and now largely completed, involved Genetic and physical mapping of chromosomes, followed by DNA sequencing

59. The science of genomics compares whole genomes –The sequencing of many prokaryotic and eukaryotic genomes Has produced data for genomics, the study of whole genomes CONNECTION

60. Besides being interesting themselves –Nonhuman genomes can be compared with the human genome Table 12.17

61. Proteomics The study of the full sets of proteins produced by organisms Biotechnology Explorer™ Protein Fingerprinting Instruction Manual

62. Biotechnology Explorer™ Protein Fingerprinting Instruction Manual

63. Techniques for manipulating DNA have potential for treating disease by altering an afflicted individual’s genes Is the alteration of an afflicted individual’s genes –Progress is slow, however –There are also ethical questions related to gene therapy Gene therapy may someday help treat a variety of diseases Figure 12.19 Cloned gene (normal allele) 1 Insert normal gene into virus Viral nucleic acid Retrovirus 2 Infect bone marrow cell with virus 3 Viral DNA inserts into chromosome Bone marrow cell from patient Bone marrow 4 Inject cells into patient

64. Our new genetic knowledge will affect our lives in many ways The deciphering of the human genome, in particular, raises profound ethical issues –Many scientists have counseled that we must use the information wisely DNA technology raises important ethical questions Figure 12.21A-C

65. Genetic engineering involves some risks –Possible ecological damage from pollen transfer between GM and wild crops –Pollen from a transgenic variety of corn that contains a pesticide may stunt or kill monarch caterpillars Could GM organisms harm human health or the environment? Figure 12.20A, B

66. Acknowledgements BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003. These images have been produced from the originals by permission of the publisher. These illustrations may not be reproduced in any format for any purpose without express written permission from the publisher. Unless otherwise noted, illustrations are credited to Pearson Education which have been borrowed from BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2001. These images have been produced from the originals by permission of the publisher. These illustrations may not be reproduced in any format for any purpose without express written permission from the publisher.