1. Designer Genes (C)-2014 KAREN LANCOUR National Bio Rules National Bio Rules Committee Chairman karenlancour@charter.net

2. Event Rules – 2014 DISCLAIMER This presentation was prepared using draft rules. There may be some changes in the final copy of the rules. The rules which will be in your Coaches Manual and Student Manuals will be the official rules.

3. Event Rules – 2014 BE SURE TO CHECK THE 2014 EVENT RULES FOR EVENT PARAMETERS AND TOPICS FOR EACH COMPETITION LEVEL BE SURE TO CHECK THE 2014 EVENT RULES FOR EVENT PARAMETERS AND TOPICS FOR EACH COMPETITION LEVEL

4. TRAINING MATERIALS Training Power Point – content overview Training Power Point – content overview Training Handout - content information Training Handout - content information Sample Tournament – sample problems with key Sample Tournament – sample problems with key Event Supervisor Guide – prep tips, event needs, and scoring tips Event Supervisor Guide – prep tips, event needs, and scoring tips Internet Resource & Training CD’s – on the Science Olympiad website at www.soinc.org under Event Information Internet Resource & Training CD’s – on the Science Olympiad website at www.soinc.org under Event Informationwww.soinc.org Biology-Earth Science CD, Genetics CD as well as the Division B and Division C Test Packets are available from SO store at www.soinc.org Biology-Earth Science CD, Genetics CD as well as the Division B and Division C Test Packets are available from SO store at www.soinc.orgwww.soinc.org

5. Designer Genes (C) Content – Molecular Genetics, Biotechnology Content – Molecular Genetics, Biotechnology  DNA structure, function and replication  Types of RNA, transcription and post-transcription modifications  Translation and Universal Code  Control of Gene Expression  Organelle DNA - mitochondrial inheritance  DNA technologies such as cloning, sequencing, analysis, fingerprinting, and PCR, gene therapy  Trinucleotide repeats and other disorders  Gene Therapy, Bioethics, and Epigenetics  Next Generation Sequencing Platform Process Skills - observations, inferences, predictions, data analysis, and calculations Process Skills - observations, inferences, predictions, data analysis, and calculations

6. GENERAL PRINCIPLES OF GENETICS for Designer Genes Students need to review the general principles of genetics Students need to review the general principles of genetics These areas are covered in the Heredity event in Division B so these event materials are a good review These areas are covered in the Heredity event in Division B so these event materials are a good review Most event supervisors include some general principles and problems on their competitions for Designer Genes Most event supervisors include some general principles and problems on their competitions for Designer Genes

7. Emphasis Scheme - General Principles plus Regional and State National (all topics) DNA structure & function Sanger DNA Sequencing Restriction mapping DNA Replication including roles of enzymes DNA fingerprinting Phylogenetics Gene expression including roles of enzymes RFLP RNA processing PromotersPCRRNA-Seq Mutations DNA microassays DNA Repair Organelle DNA Molecular cloning Epigenetics Plasmid selection and isolation Gene Therapy Next Gen Sequencing Platforms (comparison)

8. PRINCIPLES OF GENETICS GENES – come in pairs GENES – come in pairs  Section of DNA – codes protein or part of protein  One from each parent ALLELE – different forms of a gene ALLELE – different forms of a gene MULTIPLE ALLELES – more than 2 forms of a gene MULTIPLE ALLELES – more than 2 forms of a gene HOMOZYGOUS – same alleles HOMOZYGOUS – same alleles HETEROZYGOUS – different alleles HETEROZYGOUS – different alleles

9. Dominant vs. Recessive Dominant – always expressed Dominant – always expressed  Capital letters – N  Homozygous - NN  Heterozygous - Nn Recessive – prevented by dominant Recessive – prevented by dominant  Lower case letters – n  Homozygous – nn Punnett Square – Box showing allele combinations

10. Dominant and Recessive Autosomal Dominant Autosomal Dominant Dominant gene on an autosome Autosomal Recessive Autosomal Recessive Recessive gene on an autosome Sex-linked Dominant Sex-linked Dominant Dominant gene on a sex chromosome Sex-linked Recessive Sex-linked Recessive Recessive gene on a sex chromosome

11. Monohybrid Cross Hybrid – Ss X Ss One Trait – Smooth vs wrinkled Two gametes per parent S and s Punnett Square with 4 boxes – 4 offspring

12. Genotype & Phenotype Genotype Phenotype SS or Ss Round SS or Ss Round ss Wrinkled ss Wrinkled Genotype frequency 1:2:1 Phenotype frequency 3:1 3:1

13. Dihybrid Cross Dihybrid – 2 traits Gametes per parent = 4 Punnett Square – 16 boxes Genotype ratio 1:2:1:2:4:2:1:2:1 1:2:1:2:4:2:1:2:1 Phenotype ratio 9:3:3:1 9:3:3:1

14. Trihybrid Cross

15. Incomplete Dominance Hybrid is a blend of two traits Hybrid is a blend of two traits Genotype frequency Genotype frequency1:2:1 Phenotype frequency Phenotype frequency1:2:1 Examples: Examples: Flowers, Animal fur

16. Co-dominance More than one dominant allele More than one dominant allele Blood types – A,B,O alleles Blood types – A,B,O alleles Phenotypes Genotypes Phenotypes Genotypes A I A I A or I A i B I B I B or I B i AB I A I B O ii

17. Co-dominance co-dominance – both dominant alleles (genes) in an individual are expressed as blood types co-dominance – both dominant alleles (genes) in an individual are expressed as blood types A and B genes are co-dominant and both dominant over the O gene which is recessive A and B genes are co-dominant and both dominant over the O gene which is recessive

18. ABO Blood System

19. Independent Assortment vs. Linkage Independent Assortment – genes on different chromosomes separate independently during meiosis Independent Assortment – genes on different chromosomes separate independently during meiosis Linkage – genes on the same chromosome are inherited as a group Linkage – genes on the same chromosome are inherited as a group  Autosomal linkage – on autosomes  Sex-linked – on sex chromosomes

20. Linkage – Sex Linkage Linkage – genes on the same chromosome inherited as a group Linkage – genes on the same chromosome inherited as a group Sex-linkage – genes on sex chromosomes (esp. X) Sex-linkage – genes on sex chromosomes (esp. X) Y-chromosome shorter – some genes from X missing Y-chromosome shorter – some genes from X missing X-linked traits more common in men X-linked traits more common in men Men get X-chromosome from mom Men get X-chromosome from mom Red-green colorblindness, hemophilia Red-green colorblindness, hemophilia

21. Environmental influence on genes expression Gene function is influenced by environment as with identical twins Gene function is influenced by environment as with identical twins Genes have blueprint for proteins or parts of proteins Genes have blueprint for proteins or parts of proteins Proteins can be structural proteins (parts of body) or functional proteins (hormones/enzymes) Proteins can be structural proteins (parts of body) or functional proteins (hormones/enzymes)

22. Epistasis and Multifactorial Inheritance Epistasis - the interaction between two or more genes to control a single phenotype Epistasis - the interaction between two or more genes to control a single phenotype Multifactorial inheritance - many factors (multifactorial) both genetic and environmental are involved in producing the trait or condition. Examples: height, weight, cleft palate, spina bifida Multifactorial inheritance - many factors (multifactorial) both genetic and environmental are involved in producing the trait or condition. Examples: height, weight, cleft palate, spina bifida

23. Pedigree Symbols Generations Generations = I – Original Parents, II- F1 (children), III – F2 (grandchildren)

24. Pedigree – Curly vs Straight Hair Types of Analysis Relationships Relationships Dominant Gene – H Dominant Gene – HCurly Recessive Gene – h Recessive Gene – hStraight Genotypes Genotypes Phenotypes Phenotypes

25. Karyotypes Pairs 1-22 =Autosomes Pairs 1-22 =Autosomes XY = Sex chromosomes XY = Sex chromosomes Male = X & Y Male = X & Y Female = only X Female = only X Nondisjunction Nondisjunction Extra chromosomes Extra chromosomes(Trisomy) Missing chromosomes Missing chromosomes(Monosomy)

26. Cell Cycle Interphase Interphase  G1  S – DNA replicates  G2 Mitosis Mitosis  Prophase  Metaphase  Anaphase  Telophase

27. Mitosis vs Meiosis Mitosis Mitosis  Growth and Asexual Reproduction  One division – 2 diploid cells  Genetically same as original Meiosis Meiosis  Gametes for Sexual Reproduction  2 divisions – 4 haploid cells

29. CENTRAL DOGMA OF MOLECULAR GENETICS DNA ----  RNA ---  PROTEIN SYNTHESIS DNA ----  RNA ---  PROTEIN SYNTHESIS REPLICATION  TRANSCRIPTION  TRANSLATION Exceptions among viruses – RNA to DNA (retroviruses) (retroviruses)

30. DNA Structure Double helix Double helix Antiparallel Antiparallel Nucleotide Nucleotide  Deoxyribose  Phosphate  Nitrogen bases  Adenine  Thymine  Guanine  Cytosine

31. DNA Replication Replication (in nucleus) Replication (in nucleus) DNA uncoils & splits DNA uncoils & splits Reads 3’ to 5’ Reads 3’ to 5’ Assembles 5’ to 3’ Assembles 5’ to 3’ 4 types of nucleotides 4 types of nucleotides Okazaki fragments Okazaki fragments in lagging strand in lagging strand

32. ENZYMES FOR REPLICATION

33. DNA Repair Genes encode proteins that correct mistakes in DNA caused by incorrect copying during replication and environmental factors such as by- products of metabolism, exposure to ultraviolet light or mutagens Genes encode proteins that correct mistakes in DNA caused by incorrect copying during replication and environmental factors such as by- products of metabolism, exposure to ultraviolet light or mutagens The DNA repair process must operate constantly to correct any damage to the DNA as soon as it occurs The DNA repair process must operate constantly to correct any damage to the DNA as soon as it occurs

34. Gene Expression Transcription – DNA is template for making RNA (in nucleus) Transcription – DNA is template for making RNA (in nucleus) Translation (protein synthesis) - in cytoplasm at the ribosome. M-RNA has blueprint, T-RNA transfers amino acids, and Ribosome (R-RNA) allows T-RNA to attach to M-RNA at appropriate site Translation (protein synthesis) - in cytoplasm at the ribosome. M-RNA has blueprint, T-RNA transfers amino acids, and Ribosome (R-RNA) allows T-RNA to attach to M-RNA at appropriate site

35. Transcription Making RNA from DNA template Transcription takes place in the nucleus

36. Types of RNA Differences between RNA & DNA Differences between RNA & DNA  RNA is single strand - DNA is double strand  RNA has Ribose – DNA has Deoxyribose  RNA has Uracil – DNA has Thymine Messenger RNA – carries blueprint from nucleus to cytoplasm Messenger RNA – carries blueprint from nucleus to cytoplasm Transfer RNA – brings amino acids Transfer RNA – brings amino acids Ribosomal RNA – reads code and allows M-RNA and T-RNA to connect Ribosomal RNA – reads code and allows M-RNA and T-RNA to connect

37. Promoters region of DNA that initiates transcription of a particular gene region of DNA that initiates transcription of a particular gene located near the genes they transcribe, on the same strand and upstream on the DNA (towards the 3' region of the anti-sense strand located near the genes they transcribe, on the same strand and upstream on the DNA (towards the 3' region of the anti-sense strand also called template strand and non-coding strand) also called template strand and non-coding strand)

38. RNA Processing mRNA in prokaryotic cells is to function after transcription but in eukaryotic cells it is modified after transcription mRNA in prokaryotic cells is to function after transcription but in eukaryotic cells it is modified after transcription RNA Processing includes 5’ capping for RNA stabilization and ribosome binding; splicing for removing intron sequence and 3’ polyadenylation for protecting mRNA from 3’ exonuclease, extending the half life of mRNA RNA Processing includes 5’ capping for RNA stabilization and ribosome binding; splicing for removing intron sequence and 3’ polyadenylation for protecting mRNA from 3’ exonuclease, extending the half life of mRNA Eukaryotic pre-mRNA is converted into mature mRNA Eukaryotic pre-mRNA is converted into mature mRNA

39. Post-transcription Modifications Introns and exons at transcription Introns and exons at transcription Introns removed Introns removed Exons are coding pieces for protein Exons are coding pieces for protein synthesis synthesis Cap and PolyA tail are added Cap and PolyA tail are added

40. Universal Genetic Code Special start codon (AUG) and three stop codons (UAA, UAG and UGA) Special start codon (AUG) and three stop codons (UAA, UAG and UGA) Many codons may code for same amino acid Many codons may code for same amino acid Third position of the codon, it is more likely the nucleotide is different but it still may code for same amino acid (wobble) Third position of the codon, it is more likely the nucleotide is different but it still may code for same amino acid (wobble)

41. Universal Code (Codon = Amino Acid)

43. Translation (Protein Synthesis) The steps of translation The steps of translation: Initiation 1. Initiation: mRNA enters the cytoplasm and becomes associated with ribosomes (rRNA + proteins). tRNAs, each carrying a specific amino acid, pair up with the mRNA codons inside the ribosomes. Base pairing (A-U, G-C) between mRNA codons and tRNA anticodons determines the order of amino acids in a protein. Elongation 2. Elongation: addition of amino acids one-by-one: As the ribosome moves along the mRNA, each tRNA transfers its amino acid to the growing protein chain, producing the protein Termination 3. Termination: when the ribosomes hits a stop codon - UAA, UGA, or UAG - the ribosome falls apart Note: Note: The same mRNA may be used hundreds of times during translation by many ribosomes before it is degraded (broken down) by the cell

44. Control of Gene Expression in Prokaryotes Important for single celled organisms who depend on environment for all activities Important for single celled organisms who depend on environment for all activities Bacteria use operons - many functional-related genes are clustered and transcribed under the same types of regulation Bacteria use operons - many functional-related genes are clustered and transcribed under the same types of regulation Lac & Trp Operons - examples of prokaryotic gene regulation Lac & Trp Operons - examples of prokaryotic gene regulation

45. Lac Operon The genes that code for the enzymes needed for lactose catabolism are clustered on the same chromosome in what is called the Lac Operon The E. coli only express the genes and make these enzymes when lactose is available to be metabolized. This is an inducible operon where genes are expressed in the presence of a substance

46. Trp Operon The genes for the five enzymes in the Trp synthesis pathway are clustered on the same chromosome in what is called the Trp Operon The genes for the five enzymes in the Trp synthesis pathway are clustered on the same chromosome in what is called the Trp Operon This is a repressable operon where the operon are turned off in the presence of a substance This is a repressable operon where the operon are turned off in the presence of a substance

47. Regulatory Components in Eukaryotes Enhancers - short regions of DNA that can be bound with proteins to promote expression of a distal or a proximal gene. Promoters - proximal DNA sequences that binds to RNA polymerase for regulating gene expression. TATA Box - binds to transcription factor for regulating gene expression, usually within 30bp of the transcription start site.

48. Control of Gene Expression in Eukaryotes Transcriptional Control Transcriptional Control Post transcriptional Control – assembling proteins Post transcriptional Control – assembling proteins Cell differentiation and specialization Cell differentiation and specialization Turning genes “on” and “off” Turning genes “on” and “off” Chemical Signals – Hormones Chemical Signals – Hormones Chemical Modifications Chemical Modifications Relocation of DNA – transposons Relocation of DNA – transposons Abnormal Expression of Genes Abnormal Expression of Genes

49. Nuclear vs Cytoplasmic DNA in Eukaryotic Cells Nuclear DNA – in chromosomes within the nucleus of the cell Nuclear DNA – in chromosomes within the nucleus of the cell Cytoplasmic or Organelle DNA – in chloroplasts and mitochondria Cytoplasmic or Organelle DNA – in chloroplasts and mitochondria Chloroplast DNA (cpDNA) Chloroplast DNA (cpDNA) Mitochondrial DNA (mtDNA) Mitochondrial DNA (mtDNA) Features: Features: Maternal inheritance Maternal inheritance Resemble prokaryotic DNA Resemble prokaryotic DNA Slow accumulation of mutations Slow accumulation of mutations

50. Organelle DNA Mitochondria and Chloroplasts have DNA similar to Prokaryotic cells Mitochondria and Chloroplasts have DNA similar to Prokaryotic cells It is believed that these organelles were once independent prokaryotes who took up residence and formed a mutualistic relationship It is believed that these organelles were once independent prokaryotes who took up residence and formed a mutualistic relationship They are involved in energy transfer- photosynthesis & respiration They are involved in energy transfer- photosynthesis & respiration

51. MITOCHONDRIAL INHERITANCE The inheritance of a trait encoded in the mitochondrial genome The inheritance of a trait encoded in the mitochondrial genome Mitochondrial DNA or mtDNA is inherited from the mother Mitochondrial DNA or mtDNA is inherited from the mother The mtDNA is circular and resembles prokaryotic DNA The mtDNA is circular and resembles prokaryotic DNA The mitochondria are responsible for energy production – cellular respiration The mitochondria are responsible for energy production – cellular respiration

52. Mutations Mutation – any change in the DNA blueprint for making protein or RNA Mutation – any change in the DNA blueprint for making protein or RNA Gene mutation Gene mutation Chromosomal mutation Chromosomal mutation Agents causing mutations – radiation, chemicals, excess heat Agents causing mutations – radiation, chemicals, excess heat

53. Genetic Disorders Nondisjunction – extra or missing chromosomes as Down’s Syndrome Nondisjunction – extra or missing chromosomes as Down’s Syndrome Trinucleotide repeats – triplet nucleotides Trinucleotide repeats – triplet nucleotides repeated too often as Huntington’s repeated too often as Huntington’s Defective genes – does not produce correct protein as sickle cell anemia (A & T traded places) Defective genes – does not produce correct protein as sickle cell anemia (A & T traded places) Human genetic disorders Human genetic disorders – can be dominant, recessive, sex-linked, epistatic, variable expressed

54. Biotechnology Technology used to manipulate DNA Technology used to manipulate DNA Procedures often called genetic engineering Procedures often called genetic engineering Recombinant DNA - DNA from two sources Recombinant DNA - DNA from two sources Transgenic individuals have DNA from another organism Transgenic individuals have DNA from another organism Often involve putting genes into viruses or bacteria. Often involve putting genes into viruses or bacteria. Vectors are the pieces of DNA used to transfer genes into a host cell – often plasmids of bacteria Vectors are the pieces of DNA used to transfer genes into a host cell – often plasmids of bacteria

55. Overview of Biotechnology

56. Techniques Cloning within cells and with PCR Cloning within cells and with PCR Storing clones in DNA Libraries Storing clones in DNA Libraries Identifying cloned genes with Radioactive Probes Identifying cloned genes with Radioactive Probes Analyzing DNA by cutting fragments and separating by Electrophoresis/nucleic acid hybridization/DNA probes Analyzing DNA by cutting fragments and separating by Electrophoresis/nucleic acid hybridization/DNA probes Transferring DNA from gel by Blotting Transferring DNA from gel by Blotting Imaging with autoradiography Imaging with autoradiography DNA Sequencing to determine exact sequence DNA Sequencing to determine exact sequence Microassays to analyze gene function Microassays to analyze gene function

57. Basic Tools of DNA Technology Identifying desired DNA Identifying desired DNA Cutting DNA with Restriction Enzymes Cutting DNA with Restriction Enzymes Inserting DNA into Vector as Plasmid Inserting DNA into Vector as Plasmid Connecting DNA pieces with Ligase Connecting DNA pieces with Ligase Inserting Vector into Host Cell as bacterium Inserting Vector into Host Cell as bacterium Cloning desired DNA and Vectors Cloning desired DNA and Vectors Storing clones in DNA Libraries Storing clones in DNA Libraries Identifying cloned genes with Radioactive Probes Identifying cloned genes with Radioactive Probes Analyzing DNA by cutting fragments and separating by Electrophoresis Analyzing DNA by cutting fragments and separating by Electrophoresis

58. Cloning into A Plasmid Gene selection Gene selection Plasmid selection Plasmid selection Putting pieces together Putting pieces together Insert into host bacteria Insert into host bacteria Clone the bacteria Clone the bacteria

59. Gene Selection and cDNA – complementary DNA Eukaryotic genes contain introns but bacteria do not contain the necessary enzymes to remove introns Eukaryotic genes contain introns but bacteria do not contain the necessary enzymes to remove intronsintrons Eukaryotic genes that are inserted into bacteria must be inserted without introns. Eukaryotic genes that are inserted into bacteria must be inserted without introns. Use reverse transcriptase (from retroviruses) and modified M-RNA to produce cDNA with introns already removed Use reverse transcriptase (from retroviruses) and modified M-RNA to produce cDNA with introns already removed

60. Plasmid Selection and Isolation A small DNA molecule that is physically separate from, and can replicate independently of, chromosomal DNA within a cell as a bacterium A small DNA molecule that is physically separate from, and can replicate independently of, chromosomal DNA within a cell as a bacterium When used in genetic engineering – called vectors When used in genetic engineering – called vectors Several methods to isolate plasmid DNA from bacteria Several methods to isolate plasmid DNA from bacteria

61. Molecular Cloning To isolate a piece of DNA and amplify it via recombinant DNA technology. To isolate a piece of DNA and amplify it via recombinant DNA technology. The DNA source can be genomic DNA, cDNA, or PCR amplified DNA fragments. The DNA source can be genomic DNA, cDNA, or PCR amplified DNA fragments. These DNA pieces are cut by restriction enzymes to create compatible DNA ends with the vectors. These DNA pieces are cut by restriction enzymes to create compatible DNA ends with the vectors. They are then grown in E. coli for amplification. They are then grown in E. coli for amplification.

62. DNA Libraries Genomic – normal DNA Genomic – normal DNA cDNA – modified to remove introns cDNA – modified to remove introns Fragments stored Fragments stored Stored in plasmids or bacteriophages Stored in plasmids or bacteriophages

63. DNA Hybridization Base pairing of two single strands of DNA or RNA. Base pairing of two single strands of DNA or RNA. Can be DNA-DNA, DNA-RNA Can be DNA-DNA, DNA-RNA Can be a radioactive probe Can be a radioactive probe

64. Radioactive Probes short, radioactive strands of DNA short, radioactive strands of DNA will pair up with complementing strands of DNA will pair up with complementing strands of DNA fragments that contain the labeled pieces will show up on an x-ray film fragments that contain the labeled pieces will show up on an x-ray film

65. Electrophoresis A process in which molecules (such as proteins, DNA, or RNA fragments) can be separated according to size and electrical charge by applying an electric current to them.

66. DNA Analysis

67. Sanger DNA Sequencing Determine the exact nucleotide sequence Determine the exact nucleotide sequence Columns for A,T,C, and G Columns for A,T,C, and G Read top to bottom to those on the gel for the sequence strand - 5' to 3', is AATCTGGGCTACTCGGGCGT Read top to bottom the bases complementary to those on the gel for the sequence strand - 5' to 3', is AATCTGGGCTACTCGGGCGT Read bottom to top to determine complementary stand - 5' to 3' ACGCCCGAGTAGCCCAGATT Read bottom to top to determine complementary stand - 5' to 3' ACGCCCGAGTAGCCCAGATT

68. DNA Fingerprinting Techniques RFLP – Restriction Fragment Length Polymorphism (original) RFLP – Restriction Fragment Length Polymorphism (original) PCR – Polymerase Chain Reaction PCR – Polymerase Chain Reaction VNTRs – Variable Number Tandem Repeats VNTRs – Variable Number Tandem Repeats STRs - Short Tandem Repeats STRs - Short Tandem Repeats Ribosomal DNA analysis Ribosomal DNA analysis Y-chromosome analysis Y-chromosome analysis

69. Restriction Fragment Length Polymorphism - RFLP The DNA of an organism is cut up into fragments using restriction enzymes. The DNA of an organism is cut up into fragments using restriction enzymes. A large number of short fragments of DNA will be produced (RFLP’s) A large number of short fragments of DNA will be produced (RFLP’s) Electrophoresis is a technique used to separate the DNA fragments according to their size Electrophoresis is a technique used to separate the DNA fragments according to their size Uses- identification of diseased genes including oncogenes, identification of viral infections, determining family relationships among individuals, and identifying tissue found at a crime scene Uses- identification of diseased genes including oncogenes, identification of viral infections, determining family relationships among individuals, and identifying tissue found at a crime scene

70. Restriction Fragment Length Polymorphisms (RFLP) Genetic variations at the site where a restriction enzyme cuts a piece of DNA Genetic variations at the site where a restriction enzyme cuts a piece of DNA Such variations affect the size of the resulting fragments Such variations affect the size of the resulting fragments These sequences can be used as markers on physical maps and linkage maps These sequences can be used as markers on physical maps and linkage maps

71. Polymerase Chain Reaction (PCR) Technique for quickly making an unlimited number of copies of any piece of DNA Technique for quickly making an unlimited number of copies of any piece of DNA Sometimes called "molecular photocopying" Sometimes called "molecular photocopying"

72. VARIABLE NUMBER TANDAM REPEATS (VNTR’s) Short nucleotideShort nucleotide sequencessequences Organized in clustersOrganized in clusters of tandem repeats VNTR = 14-100 base pairsVNTR = 14-100 base pairs SNR = 2- 10 base pairsSNR = 2- 10 base pairs

73. Restriction Mapping Description of restriction enzyme cleavage sites within a piece of DNA Description of restriction enzyme cleavage sites within a piece of DNA Use of different restriction enzymes to analyze and generate a physical map of genomes, genes, or other segments of DNA Use of different restriction enzymes to analyze and generate a physical map of genomes, genes, or other segments of DNA

74. DNA Microassay studying how large numbers of genes interact with each other studying how large numbers of genes interact with each other precisely apply tiny droplets containing functional DNA to glass slides precisely apply tiny droplets containing functional DNA to glass slides attach fluorescent labels to DNA from the cell they are studying. attach fluorescent labels to DNA from the cell they are studying. labeled probes are allowed to bind to complementary DNA strands on the slides labeled probes are allowed to bind to complementary DNA strands on the slides slides are put into a scanning microscope that can measure the brightness of each fluorescent dot slides are put into a scanning microscope that can measure the brightness of each fluorescent dot brightness reveals how much of a specific DNA fragment is present, an indicator of how active it is brightness reveals how much of a specific DNA fragment is present, an indicator of how active it is

75. RNA-Seq RNA-seq refers to the method of using Next Generation Sequencing (NGS) technology to measure a set of RNA levels RNA-seq refers to the method of using Next Generation Sequencing (NGS) technology to measure a set of RNA levels NGS technology is an ultra-high-throughput technology to measure DNA sequences NGS technology is an ultra-high-throughput technology to measure DNA sequences Advantages of RNA-seq over microarray include: Advantages of RNA-seq over microarray include: 1) Wider measurable range of expression levels 2) Not dependent on known genome 3) Free of hybridization artifacts 4) Possibility of one platform for all applications

76. Second-generation DNA sequencing technologies

77. Applications of Biotechnology Techniques Human Genome Project Human Genome Project Diagnosis of Disease – PCR & DNA probes Diagnosis of Disease – PCR & DNA probes Human Gene Therapy Human Gene Therapy Vaccines & Pharmaceutical Products Vaccines & Pharmaceutical Products Forensics – DNA Fingerprints (RFLP & VNTR) Forensics – DNA Fingerprints (RFLP & VNTR) Environmental – Recycling & detoxification Environmental – Recycling & detoxification Agricultural – transgenic organisms Agricultural – transgenic organisms

78. Bioethics Potential Hazards vs. Potential Gains Potential Hazards vs. Potential Gains Concerns: Concerns: genetically modified foods genetically modified foods genetically engineering microbes genetically engineering microbes cloning whole organisms cloning whole organisms embryonic stem cell research embryonic stem cell research gene therapy gene therapy genetic testing genetic testing bioterrorism bioterrorism

79. Epigenetics The study of heritable changes in gene activity that occur without a change in the sequence of the genetic material. Epigenetics literally means ‘in addition to genetics’. The study of heritable changes in gene activity that occur without a change in the sequence of the genetic material. Epigenetics literally means ‘in addition to genetics’. Epigenetic factors can regulate the amount of gene activity, influencing the growth and appearance of an organism Epigenetic factors can regulate the amount of gene activity, influencing the growth and appearance of an organism Malfunctions in epigenetic control of gene activity have been implicated in cancer, cardiovascular disease and several inherited genetic conditions Malfunctions in epigenetic control of gene activity have been implicated in cancer, cardiovascular disease and several inherited genetic conditions

80. Phylogenetics Study of evolutionary relationships among groups of organisms based upon their genetics Study of evolutionary relationships among groups of organisms based upon their genetics Has taxonomy folks in a turmoil – they can’t agree so we have national lists for our taxonomy events Has taxonomy folks in a turmoil – they can’t agree so we have national lists for our taxonomy events