1. Chapter 26 Lecture Outline Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. See separate PowerPoint slides for all figures and tables pre-inserted into PowerPoint without notes. 1

2. 2 Chapter 26 Taxonomy and Systematics Taxonomy Phylogenetic Trees Cladistics Molecular Clocks Horizontal Gene Transfer Key Concepts:

3. Taxonomy  Science of describing, naming, and classifying living and extinct organisms and viruses Systematics  Study of biological diversity and the evolutionary relationships among organisms, both extinct and modern Taxonomic groups are based on hypotheses regarding evolutionary relationships derived from systematics 3 Taxonomy

4. Hierarchical system involving successive levels Each group at any level is called a taxon Highest level is Domain  All of life belongs to one of 3 domains  Bacteria, Archaea, and Eukarya 4

5. 5

6. 6 Domains: Eukaryotic supergroups: Typical protists: Large eukaryotic kingdoms: BacteriaArchaeaEukarya Excavata Plantae Land plants and relativesAlveolataStramenopilaRhizariaAmoebozoaOpisthokonta AnimaliaFungi Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

7. 7 1 7 Taxonomic group Gray wolf found in Number of species Domain Supergroup Kingdom Phylum Class Order Family Genus Specieslupus Canis Canidae Carnivora Mammalia Chordata Animalia Opisthokonta Eukarya~4 –10 million >1 million ~50,000 ~5,000 ~270 34

8. Binomial nomenclature Genus name and species epithet ex: Homo sapiens Genus name always Capitalized Species epithet never capitalized Both names either italicized or underlined Rules for naming established and regulated by international associations 8

9. Phylogeny – evolutionary history of a species or group of species To propose a phylogeny, biologists use the tools of systematics Trees are usually based on morphological or genetic data 9 Phylogenetic Trees

10. Phylogenetic tree Diagram that describes phylogeny A hypothesis of evolutionary relationships among various species Based on available information New species can be formed by  Anagenesis – single species evolves into a different species  Cladogenesis – a species diverges into two or more species 10

11. 11 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5 Millions of years ago (mya) Time Present Species F, I, G, J, H, and K at the tips of branches in the present are extant species that still exist. Cladogenesis: Species A diverged into species A and B. Branch points or nodes indicate when a species diverged into 2 or more different species. 10 B C D E FG H I JK Species B and E at the tips of branches in the past are extinct species. Anagenesis: Species C evolved into species G. Clade: This group includes all of the species that were derived from the ancestor, species D. B A

12. 12 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 500 million Present 1 billion 12345678910111213141516171819202122232425262728293031323352535455565758596061626364 Millions of years ago (mya) Time Species (43) 343536373839404546474849505141424344 Family (species 41–44) Genus(species 43–44) Order (species 41–48) Class (species 33–48) Phylum (species 33–64) Kingdom (species 1–64)

13. Monophyletic group or clade  Group of species, taxon, consisting of the most recent common ancestor and all of its ancestors Smaller and more recent clades are nested within larger clades that have older common ancestors Paraphyletic group  Contains a common ancestor and some, but not all, of its descendents 13

14. 14 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DEFG BC A DEFG BC A DEFG BC A HIJKLMNO A monophyletic group contains a common ancestor and all of its descendants. HIJKLMNO A paraphyletic group contains a common ancestor but not all of its descendants. HIJKLMNO A polyphyletic group contains groups of species with different common ancestors. (a) Monophyletic group(b) Paraphyletic group(c) Polyphyletic group

15. Over time, taxonomic groups will be reorganized so only monophyletic groups are recognized Reptiles were a paraphyletic group because birds were excluded 15 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. TurtlesLizards and snakes CrocodilesBird Turtles Reptiles Orders Classes Lizards and snakes Crocodiles (a) Reptiles as a paraphyletic taxon (b) Reptiles as a monophyletic taxon Bird KEY

16. Homology Similarities among various species that occur because they are derived from a common ancestor ex: Bat wing, human arm and cat front leg Genes can also be homologous if they are derived from the same ancestral gene 16

17. Morphological analysis First systematic studies focused on morphological features of extinct and modern species Convergent evolution (traits arising independently due to adaptation to similar environments) can cause problems 17

18. 18 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 0 5 10 20 40 55 Millions of years ago (mya) Hyracotherium Pachynolophus Propalaeotherium Paleotherium Orohippus Epihippus Mesohippus Miohippus Parahippus Anchitherium Hypohippus Sinohippus Archaeohippus Megahippus Merychippus Callippus Pliohippus Equus Neohipparion Nannippus Hipparion Stylohipparion Time Hippidium and other genera An analysis of fossilized bones provided the phylogenetic tree described here.

19. Molecular systematics Analysis of genetic data, such as DNA and amino acid sequences, to identify and study genetic homologies and propose phylogenetic trees DNA and amino acid sequences from closely related species are more similar to each other than to sequences from more distantly related species 19

20. Study and classification of species based on evolutionary relationships Cladistic approach discriminates among possible trees by considering the various possible pathways of changes and then choosing the tree that requires the least complex explanation Make phylogenetic trees or cladograms 20 Cladistics

21. Cladistic approach compares homologous traits, also called characters, which may exist in two or more character states Shared primitive character or symplesio-morphy  Shared by two or more different taxa and inherited from ancestors older than their last common ancestor Shared derived character or synapo-morphy  Shared by two or more species or taxa and has originated in their most recent common ancestor  Basis of the cladistic approach is to analyze many shared derived characters to deduce the pathway that gave rise to those species 21

22. 22 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. A B G D E F C 2 eyes, 2 front legs 2 eyes, 2 front legs 2 eyes, 2 front flippers With regard to species D and E, having 2 eyes is a shared primitive character, whereas having 2 front flippers is a shared derived character.

23. Branch point – two species differ in shared derived characters Ingroup – group we are interested in Outgroup – species or group of species that is assumed to have diverged before the species in the ingroup An outgroup will lack one or more shared derived characters that are found in the ingroup 23

24. 24 (b) Cladogram based on morphological traits Mammary glands Tetrapod Hinged jaw Vertebrae Notochord Yes No Vertebrae Hinged jaw Tetrapod YesMammary glands Yes RabbitLizardSalmonLampreyLancelet Yes (a) Characteristics among species No LanceletLampreySalmonRabbitLizard Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

25. Cladogram can also be constructed with gene sequences 7 species called A-G A mutation that changes the DNA sequence is analogous to a change of a characteristic 25

26. 26 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GGTATAACCC A6 T EDGFABC T5 G C10G G2A A7T C10A GGTATAACCC 1 2 3 4 5 6 7 8 9 10 GGTATTACCCGGTAGTACCCGGTAGTACCAGATAGTACCCGATAGTTCCCGATA GTTCCG Proposed primitive sequence

27. Constructing a cladogram 1. Choose species 2. Choose characters 3. Determine polarity of character states  Primitive or derived? 27

28. 4. Analyze cladogram  All species (or higher taxa) are placed on tips in the phylogenetic tree, not at branch points  Each cladogram branch point should have a list of one or more shared derived characters that are common to all species above the branch point unless the character is later modified  All shared derived characters appear together only once in a cladogram unless they arose independently during evolution more than once

29. 5. Choose the most likely cladogram among possible options 6. Choose a noncontroversial outgroup as root

30. Principle of parsimony Preferred hypothesis is the one that is the simplest for all the characters and their states Challenge in a cladistic approach is to determine the correct polarity of events  It may not always be obvious which traits are primitive (came earlier) and which are derived (came later in evolution)  Fossils may be analyzed to help resolve 30

31. Example 4 taxa (A-D) A is the outgroup  Has all primitive states 3 potential trees  Tree 3 requires fewest number of mutations so is the most parsimonous 31

32. 32 According to the principle of parsimony, tree number 3 is the more likely choice because it requires only five mutations. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GTACA T2A A GACAG B GTCAA C GACCG D C4A A5G T2A C4A A5G A3C Tree 1 requires 7 mutations. GTACA DBCA GACCGGACAGGTCAA T2A A A5G G A3C C4A Tree 2 requires 6 mutations. GTACA A GTCAA C GACAG B GACCG D C4A A A3C T2A A5G Tree 3 requires 5 mutations.

33. Cooper and Colleagues Compared DNA from Extinct Flightless Birds and Existing Species to Propose a New Phylogenetic Tree Ancient DNA analysis or molecular paleontology Under certain conditions DNA samples may be stable as long as 50,000 – 100,000 years Discovery-based science – gather data to propose a hypothesis Sequences are very similar New Zealand colonized twice by the ancestors of flightless birds  First by moa ancestor, then by kiwi ancestor

34. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Experimental levelConceptual level 2 3 PCR technique GOAL To gather molecular information to hypothesize about the evolutionary relationships among these species. KEY MATERIALS Tissue samples from 4 extinct species of moas were obtained from museum specimens. Tissue samples were also obtained from 3 species of kiwis, 1 emu, 1 cassowary, 1 ostrich, and 2 species of rheas. Isolate and purify the DNA released from the tissue. Treat the cells so that the DNA is released. Cells in tissue Mitochondrial DNA Tissue sample Individually, mix the DNA samples with a pair of PCR primers that are complementary to the SSU rRNA gene. Add PCR primers. DNA Subject the samples to PCR, as described in Chapter 20, which makes many copies of the SSU rRNA gene. 1 Many copies of the SSU rRNA gene are made. Mitochondrial DNA Primers

35. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 4 5 Subject the amplified DNA fragments to DNA sequencing, as described in Chapter 20. Align the DNA sequences to each other, using computer techniques described in Chapter 21. The amplification of the SSU rRNA gene allows it to be subjected to DNA sequencing. Align sequences to compare the degree of similarity. Sequence the amplified DNA. Align sequences, using computer programs.

36. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Africa New Zealand South America Australia and New Guinea Time Rhea 1Rhea 2 Ostrich Emu Kiwi 3 Kiwi 2 Kiwi 1 Moa 1 Moa 2 Moa 3 Moa 4 Cassowary

37. Favorable mutations are rare, detrimental mutations are quickly eliminated – so most mutations are neutral If neutral mutations occur at a constant rate they can be used to measure evolutionary time Not perfectly linear over long periods of time  Not all organisms evolve at the same rate  Differences in generation times 37 Molecular Clocks

38. 38 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 0 Nucleotide differences in a homologous gene between different pairs of species Evolutionary time since divergence of pairs of species (millions of years) This data point came from two species that had a distant common ancestor and show many nucleotide differences. This data point came from two species that had a recent common ancestor and show few nucleotide differences.

39. Primate evolution example Evolutionary relationships derived from DNA sequences for cytochrome oxidase subunit II  Tends to change fairly rapidly on an evolutionary timescale, so good for close relationships Three branch points to examine (A, D, E) Ancestor A  This ancestor diverged into two species that ultimately gave rise to siamangs and the other five species  23 million years for siamang genome to accumulate changes different from other 5 species 39

40. 40 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Present Long time to accumulate random neutral changes Siamangs (Hylobates syndactylus) Orangutans (Pongo pygmaeus) A B C E 20 25 10 15 5 D Gorillas (Gorilla gorilla) Humans (Homo sapiens) Common chimpanzees (Pan troglodytes) Pygmy chimpanzees (Bonobos) (Pan paniscus) Moderate time Short time Millions of years ago (mya) Time

41. Ancestor D  This ancestor diverged into two species that eventually gave rise to humans and chimpanzees  Differences in gene sequences between humans and chimpanzees are relatively moderate Ancestor E  This ancestor diverged into two species of chimpanzees  Two modern species of chimpanzees have fewer differences in their gene sequences 41

42. 42 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Present Long time to accumulate random neutral changes Siamangs (Hylobates syndactylus) Orangutans (Pongo pygmaeus) A B C E 20 25 10 15 5 D Gorillas (Gorilla gorilla) Humans (Homo sapiens) Common chimpanzees (Pan troglodytes) Pygmy chimpanzees (Bonobos) (Pan paniscus) Moderate time Short time Millions of years ago (mya) Time

43. Any process in which an organism incorporates genetic material from another organism without being the offspring of that organism Vertical evolution  Changes in groups due to descent from a common ancestor 43 Horizontal Gene Transfer

44. Due to Horizontal Gene Transfer, the Tree of Life Is Really a “Web of Life” Horizontal gene transfer is the transfer of genes between different species Significant role in phylogeny of all living species Still prevalent among prokaryotes but less common in eukaryotes Horizontal gene transfer may have been so prevalent that the universal ancestor may have been a community of cell lineages

45. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Time Common ancestral community of primitive cells Eukarya FungiAnimalsPlants BacteriaArchaea Present 4 billion years ago Bacterium that gave rise to chloroplasts Bacterium that gave rise to mitochondria Horizontal gene transfer Vertical evolution KEY