1. Amino acid sequence of His protein DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that make up a protein Protein Synthesis & Gene Expression nucleotide sequence of His protein

2. Protein Synthesis & Gene Expression

3. Protein Synthesis = Gene Expression The process in which the instructions encoded by a gene are used to build a protein Gene DNA in the nucleus mRNA made in nucleus, exits out of a pore in the nuclear envelope and finds a ribosome in the cytoplasm transcription polypeptide built out of amino acids by a ribosome in the cytoplasm using instructions from an mRNA translation protein Final resulting molecule after polypeptide is modified and folded into final shape in the rough ER Packaged into a vesicle in the golgi and shipped out to where it is needed

5. Protein Synthesis & Gene Expression Transcription RNA polymerase makes an mRNA (messenger RNA) copy of a gene occurs in cytoplasm of prokaryotes, nucleus of eukaryotes Enables cell to make many copies of a gene so that a lot of protein can be made at one time Enables eukaryotic cells to keep DNA protected in the nucleus, only mRNA copies of genes leave the nucleus

6. (eukaryotes) 1) INITIATION Transcription Initiation RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene Promoters are specific to genes RNA polymerase does not need a primer Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor Protein Synthesis & Gene Expression HONORS

7. 1) INITIATION Transcription Elongation RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) recall RNA uses uracil instead of thymine AGTCAT UCAGUA Protein Synthesis & Gene Expression HONORS

8. Transcription Elongation The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes Protein Synthesis & Gene Expression RNA polymerase slides down the template strand connecting together RNA nucleotides

9. 1) INITIATION Transcription Termination A region on DNA known as the terminator signals the stop of a gene RNA polymerase separates from the mRNA and the DNA Protein Synthesis & Gene Expression HONORS

11. Exons are “coding” regions provide instructions for one or more proteins) Introns are removed different combinations of exons form different mRNA resulting in multiple proteins from the same gene Humans have 30,000 genes but are capable of producing 100,000 proteins Alternative Splicing (eukaryotes only) Protein Synthesis & Gene Expression HONORS

12. Web Resources Transcription http://www.biostudio.com/d_%20Transcription.htm http://www.youtube.com/watch?v=WsofH466lqk http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html Alternative Splicing http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related

14. Protein Synthesis & Gene Expression Translation mRNA is used by ribosome to build polypeptides (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the polypeptide) occurs in cytoplasm of prokaryotes and eukaryotes some polypeptides feed directly into rough ER in eukaryotes where they are modified and folded into the final protein Transcription Translation mRNA tRNA synthesis

15. Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) AUGGACAUUGAACCG… 5’3’ start codon Transcription Translation mRNA tRNA synthesis Protein Synthesis

16. Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) Ribosome binding site on the mRNA binds to a small ribosomal subunit Then this complex binds to a large ribosomal subunit forming the complete ribosome Protein Synthesis & Gene Expression

17. Translation Scanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct polypeptide Protein Synthesis & Gene Expression

18. Transcription Translation mRNA tRNA synthesis Translation Scanning Every three mRNA nucleotides (codon) specify an amino acid Protein Synthesis & Gene Expression

19. Translation Scanning Each tRNA carries a specific amino acid tRNA have an anticodon region that specifically binds to its codon Protein Synthesis & Gene Expression anticodon

20. Translation Termination Ribosome disengages from the mRNA when it encounters a stop codon Protein Synthesis

21. Web Resources Translation Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm http://www.johnkyrk.com/DNAtranslation.html http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html http://www.dnalc.org/resources/3d/TranslationAdvanced.html

22. Post-Translational Modifications Polypeptide is modified in the rough ER – this might include cutting out sections and/or cut a section from one part of the polypeptide and moving it to another part Chaperone proteins help to fold the polypeptide into its final tertiary shape. Now it is called a protein. Protein Synthesis & Gene Expression

23. Folded membrane that forms compartments where newly synthesized proteins are processed (cut, joined, folded into their final shape) Ribosomes bind to rough ER when they start to synthesize proteins that are intended to be exported from the cell – the proteins enter the ER directly from the ribosome Rough Endoplasmic Reticulum (ER) Protein Synthesis & Gene Expression

24. Folded membranes form compartments that each contain different enzymes which selectively modify the contents depending on where they are destined to end up Processes and packages macromolecules produced by the cell (e.g. proteins and lipids) – sent out as excretory vesicles “labeled” for their destination Golgi Apparatus Protein Synthesis & Gene Expression

25. Multiple RNA polymerases can engage a gene at one time Multiple ribosomes can engage a single mRNA at one time DNA mRNAs Transcription Translation Protein Synthesis & Gene Expression

26. Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm Protein Synthesis & Gene Expression

27. There are three main types of RNA: 1.mRNA (messenger RNA) - RNA copy of a gene used as a template for protein synthesis 2.rRNA (ribosomal RNA) - part of structure of ribosomes 3.tRNA (transfer RNA) - amino acid carrier that matches to mRNA codon Protein Synthesis & Gene Expression

28. Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC

29. Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

30. Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

31. Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC S – Y –H– T – H – P – S – S – S - S Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser

32. Protein Synthesis & Gene Expression Protein Synthesis = Gene Expression Process in which a gene is used to build a protein resulting in the presence of a particular phenotype (physical characteristic) Phenotypic variation among organisms is due to genotypic variation (differences in the sequence of their DNA bases) Differences exist between species and within a species Different genes (genomes)  different proteins (proteomes) Different versions of the same gene = alleles Differences in gene expression = epigenetics

33. Insulin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html Hemoglobin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html Collagen Example of Protein Synthesis http://www.biotopics.co.uk/JmolApplet/collagen.html Web Resources