Presentation is loading. Please wait.

Presentation is loading. Please wait.

Transcription vs. Translation

Published byNicholas Cullen Modified over 10 years ago

Similar presentations

Presentation on theme: "Transcription vs. Translation"— Presentation transcript:

1 Transcription vs. Translation
Making Proteins

2 Bring amino acids to ribosome
Reviewing RNA Section 12-3 RNA can be Messenger RNA Ribosomal RNA Transfer RNA also called which functions to also called which functions to also called which functions to mRNA Carry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome from to to make up DNA Ribosome Ribosomes

3 Transcription RNA polymerase binds to DNA and separates the DNA strand. Then RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA

4 Transcription Section 12-3 RNA polymerase DNA RNA
Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase DNA RNA

5 How does RNA read DNA? What is a codon?
Three nucleotides How does the RNA know where to start? DNA polymerase only binds to promoters Specific codon that signifies the beginning of a sequence (AUG or methionine) How does the RNA know when to stop? Specific codons that signify the end of a protein chain (there are 3 of them)

6 Transcription Video Click Here

7 Transcription Activity
The following is a DNA code. Translate them into RNA and then into a protein chain using page 303 in your textbook: DNA= TAC CGA TTA GCG ATG AGT AGA ACT RNA= AUG GCU AAU CGC UAC UCA UCU UGA Start Alanine Asparagine Arginine Tyrosine Serine Serine Stop

8 Transcription vs. Translation
Making Proteins

9 Bring amino acids to ribosome
Reviewing RNA Section 12-3 RNA can be Messenger RNA Ribosomal RNA Transfer RNA also called which functions to also called which functions to also called which functions to mRNA Carry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome from to to make up DNA Ribosome Ribosomes

10 Reviewing Transcription
Making mRNA from Copying DNA How is it different from DNA Replication? DNA Replication Transcription Copies both strands making 2 new DNA molecules Copies one strand of DNA making 1 mRNA Uses DNA Polymerase Uses RNA polymerase Happens when cell splits Happens all the time

11 Translation Cell uses information from mRNA to produce proteins
tRNA brings amino acids to the mRNA chain Anticodon on tRNA binds to codon on mRNA Amino Acids are bonded to each other in a process called elongation

12

13 Section 12-3

14 Translation Video Click HERE

15 Activity Transcribe and then Translate the following DNA code into a protein chain. ATTACACCGCATATACTAAC

16 Homework Explain the entire process for creating a protein (transcriptions and translation) Use the following DNA code to help you: TCTACGCAAAGACCTTAGCATATAACACTTAG Use pictures or drawings to illustrate what is happening in each step Use the following vocab words: RNA polymerase, Codon, Anticodon, Elongation, DNA, mRNA, tRNA, amino aicd, protein

Download ppt "Transcription vs. Translation"

Similar presentations

RNA and Protein Synthesis

RNA and Protein Synthesis
RNA and Protein Synthesis

RNA and Protein Synthesis
RNA Transcription.

RNA Transcription.
RNA and PROTEIN SYNTHESIS

RNA and PROTEIN SYNTHESIS
Protein Synthesis (Gene Expression). Review Nucleotide sequence in DNA is used to make proteins that are the key regulators of cell functions. Proteins.

Protein Synthesis (Gene Expression). Review Nucleotide sequence in DNA is used to make proteins that are the key regulators of cell functions. Proteins.
Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,

Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
VII RNA and Protein Synthesis

VII RNA and Protein Synthesis
Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.
Interest Grabber DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s encyclopedia. Suppose.

Interest Grabber DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s encyclopedia. Suppose.
Central Dogma DNA RNA Protein. What are chromosomes? Where are they found? Chromosome Histones DNA double helix.

Central Dogma DNA RNA Protein. What are chromosomes? Where are they found? Chromosome Histones DNA double helix.
Protein Synthesis 1 Background Information All information is stored in DNA All information is stored in DNA RNA “reads” the DNA code RNA “reads” the.

Protein Synthesis 1 Background Information All information is stored in DNA All information is stored in DNA RNA “reads” the DNA code RNA “reads” the.
BELLRINGER: 10-31-10 Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.

BELLRINGER: Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.
DNA Replication to Transcription to Translation. DNA Replication Replication : DNA in the chromosomes is copied in the nucleus. DNA molecule is unzipped.

DNA Replication to Transcription to Translation. DNA Replication Replication : DNA in the chromosomes is copied in the nucleus. DNA molecule is unzipped.
11-18-08. DNA Review  Contains the genetic instructions used in the development and functioning of all organisms  Found in the nucleus of cells!  Made.

DNA Review  Contains the genetic instructions used in the development and functioning of all organisms  Found in the nucleus of cells!  Made.
RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.

RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.
RNA and Protein Synthesis

RNA and Protein Synthesis
Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.
Interest Grabber Information, Please DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s.

Interest Grabber Information, Please DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s.
12-3 RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

Similar presentations

Ads by Google