1. 3.5 Transcription and Translation Page 68 in your book

2. Central Dogma of Biology DNA  RNA (mRNA specifically)  protein DNA is the “control center”  More specifically, DNA has control over protein synthesis

3. So, what’s the point? There are a lot of different proteins that help YOU function  Enzymes  Antibodies  Hormones (some)  Cell membrane proteins

4. Proteins Synthesis is Controlled by 2 sets of reactions  Transcription  Translation Both produce or require RNA

5. Quick Review: Compare DNA & RNA DNARNA Contains 5 carbon sugar 5 carbon sugar is deoxyribose5 carbon sugar is ribose Each nucleotide has 1 of 4 nitrogenous bases Bases: adenine, thymine, cytosine, guanine Bases: adenine, uracil, cytosine, guanine Double strandedSingle stranded

6. Examiners Note The command term “compare” requires both similarities and differences You may give your answer in a table

7. Transcription produces RNA The sections of DNA that code for polypeptides are called genes  Any 1 gene is a specific sequence of bases found in a specific location in a DNA molecule DNA is found in the nucleus Yet, proteins are made in ribosomes (located in the cytoplasm)  So, there must be an intermediary molecule to carry the message of DNA to the cytoplasm  This is RNA

8. Transcription Process Begins when an area of DNA becomes “unzipped”  Only the location where the gene is found is unzipped The 2 complementary strands are now single stranded Only 1 strand is used as a template to create mRNA Enzyme = RNA polymerase Page 70 in book (figure 3.15)

9. Transcription process RNA nucleotides float into place by complementary base pairing  A & U; C & G Facts to consider:  Transcription occurs in the nucleus  Only 1 strand of the DNA is used as a template  mRNA is always single stranded; shorter than the DNA  No thymine in RNA  Uracil in RNA

10. Transcription Animation http://www- class.unl.edu/biochem/gp2/m_biology/animati on/gene/gene_a2.html http://www- class.unl.edu/biochem/gp2/m_biology/animati on/gene/gene_a2.html

11. Exit Slip Proper heading; Title = Transcription Exit Slip 1. Compare the structure of DNA and RNA (three comparisons) 2. Where does transcription occur? 3. If a DNA strand reads: ATCGCCATAGGC, what would the transcribed strand of mRNA read?

12. The genetic code is written in triplets The message written into the mRNA molecule determines the order of amino acids  Remember, amino acids covalently bonded  polypeptide The genetic code is written in 3 bases  Every 3 bases is enough information to code for 1 of the 20 amino acids  3 bases = codon  There are 64 possible combinations of 3 base triplets 3 of the 64 signal stop

13. 3 types of RNA mRNA  mRNA is a complementary copy of a DNA gene; codes for a single polypeptide rRNA  Ribosomal RNA  Each ribosome is composed of rRNA and protein tRNA  Transfer RNA  Each tRNA transfers 1 of the 20 amino acids to the ribosome for polypeptide formation  Page 71 figure 3.16

14. Translation results in a polypeptide Once mRNA is transcribed, the mRNA detaches from the DNA  DNA closes back up; no changes to DNA Floats out of nucleus through a pore and into the cytoplasm The mRNA will then locate a ribosome

15. Translation process A specific tRNA molecule now floats in Page 73 figure 3.17 in book Its tRNA anti codon must be complementary to the first codon triplet of the mRNA molecule  Each tRNA brings an amino acid  The amino acids are held together by peptide bonds (this is a condensation reaction)

16. Translation process The bond between the tRNA and amino acid is broken The tRNA floats away; reloads with another amino acid of the same type The process continues until a stop codon is reached The entire polypeptide breaks away; free floating in the cytoplasm

17. Translation Animations http://www- class.unl.edu/biochem/gp2/m_biology/animati on/gene/gene_a3.html http://www- class.unl.edu/biochem/gp2/m_biology/animati on/gene/gene_a3.html Transcribe and translate a gene – good practice  http://learn.genetics.utah.edu/content/begin/dna/tr anscribe/ http://learn.genetics.utah.edu/content/begin/dna/tr anscribe/

18. Exercises #15, 16 page 74 See next slide for an mRNA codon chart

20. Answers 15) A. methionine – proline – arginine – threonine – phenylalanine – proline – serine – proline – glycine B. TACGGGGCGTGCAAAGGTTCGGGGCCC C. methionine – serine – arginine – threonine – phenylalanine – proline – serine – proline – glycine (note only the 2 nd amino acid has been changed)

21. Answers 16. A substitution will change only a single triplet and thus can change the identity of only one amino acid within a polypeptide. A deletion shifts the groupings of bases by one base. This means that the triplets are all changed and therefore many amino acids will be altered within the polypeptide.