1. AMINO ACID
tRNA
ANTICODON 
CODON 
mRNA

2. Everything in you is made of or by proteins!
Protein Examples
Hemoglobin is a protein in your blood that transports oxygen
Collagen is a proteins that makes your cartilage and tendons
Keratin is a protein that makes up your hair & fingernails
Enzymes that break down your food are proteins
Everything in you is made of or by proteins!

3. DNA is like a code that instructs the cell to make proteins
A gene is a sequence of DNA that carries the code for making one protein

4. DNA – Deoxyribonucleic acid RNA – Ribonucleic Acid
Nitrogen Bases
Sugars
&
Phosphates
RNA
DNA
RNA is like DNA except…
DNA – Deoxyribonucleic acid RNA – Ribonucleic Acid
* 2 strands vs. 1 strand
* Thymine vs. Uracil (others are the same)
* Deoxyribose vs. Ribose
* Nucleus vs. Cytoplasm

5. Types of RNA mRNA – “messenger” RNA tRNA – “transfer” RNA
- Carries copies of instructions from DNA for making amino acids into proteins
tRNA – “transfer” RNA
- Transfers each amino acid to the ribosome as specified by the code on mRNA
rRNA – “ribosomal” RNA
- Makes up part of the ribosome, where proteins are made

6. 2 parts of protein synthesis:
Both DNA and RNA are involved in protein synthesis
2 parts of protein synthesis:
Transcription – DNA is converted to RNA
Occurs in the nucleus
Translation – RNA is converted to a protein
- Occurs in the cytoplasm

7. Protein Synthesis Transcription (the 1st part of Protein Synthesis)
Converts DNA to RNA
DNA (in the nucleus) needs to send a code to the ribosome (in the cytoplasm)
Problem: DNA can’t fit through the nuclear pores
A special “messenger” is used to copy and carry the code…
Ribosome

8. Protein Synthesis Transcription Cont’d
messenger RNA (mRNA) goes into the nucleus and copies the DNA
Uses enzyme – RNA Polymerase
DNA AGGTATCGCAGATCGACAGATC
RNA
UCCAUAGCGUCUAGCUGUCUAG
The next step is that mRNA moves from the nucleus to the cytoplasm and to the ribosome

9. p367

10. Translation (2nd part of protein synthesis)
Amino acids – building blocks of proteins, carried to ribosomes by ______________
Polypeptides – long chains of ____________
Codon – group of ____ nucleotide bases in mRNA which carries code for making _______________________
Ex:
Anticodon – group of _____ nucleotide bases in tRNA which is complementary to one ___________________
tRNA
Amino Acids 3
ONE amino acid
AUG - Methionine 3
codon

11. Translation Cont’d ____________ attaches to the ribosome
____________ carries amino acids to the ribosome and matches them to the coded mRNA message (codon)
Amino acids bond together, forming a long chain called a ____________________
Finally, polypeptides fold into various types of proteins and there you have it!
mRNA
tRNA
Polypeptide chain

12. Translation (the 2nd part of Protein Synthesis)
Translation – a process that converts mRNA into a protein
Occurs on the ribosome in the cytoplasm of a cell
______________ - building blocks of proteins; join together into long chains called polypeptides
____________ - a sequence of 3 bases on mRNA that codes for a single amino acid
_____________ – sequence of 3 bases on tRNA that is complementary to one mRNA codon
Amino acids
Codon
Anticodon
“UCU” is the codon that makes an amino acid called SERINE

13. The tRNA lines up with 3 bases in mRNA (codon)
tRNA anticodon GAA
mRNA codon CUU
Another form of RNA called transfer RNA (tRNA) carries amino acids to the ribosome and matches them to the coded mRNA message
tRNA drops off the amino acid in the correct spot
mRNA attaches to the ribosome

14. AMINO ACID
tRNA
ANTICODON 
CODON 
mRNA

17. Mutations
Any change in the DNA structure (specifically the order of nitrogen bases) is a mutation.
Mutations can be helpful, harmful, or neutral.
Helpful – can create diversity in a population
Harmful – can cause things like cancer
Neutral – can have absolutely no effect at all
A mutagen is something that causes mutations in the DNA (for example: smoking, radiation from the sun etc)
Slooze Worm

18. Mutations
An insertion mutation is when a nitrogen base is added to the existing DNA
A deletion mutation is when a nitrogen base is subtracted from the DNA
A substitution mutation is when one nitrogen base is put in place of another.
If our DNA was AATTGGCC
An insertion would be AATTAGGCC
A deletion would be AATGGCC
A substitution would be AAATGGCC

19. Gene Sequencing – Determining the order of nucleotide bases within a gene
DNA Fingerprinting – technique used in criminal investigations. DNA Fingerprinting takes the DNA out of a cell and separates it. This will allow investigators to distinguish body cells of different individuals (since they are unlikely to have the same DNA)
Cloning – take the DNA out of one of your cells then take the DNA out of a zygote (fertilized egg). Put the DNA from your cell into the zygote.

20. Genetic engineering is the process of moving genes from the chromosomes of one organism to those of another organism.
Recombinant DNA is formed by joining DNA molecules.from two different organisms
Animation

22. What would represent the strand of DNA from which the mRNA strand in the diagram was made?
A.CUCAAGUGCUUCB.GAGUUCACGAAG
C.GAGTTCACGAAGD.AGACCTGTAGGA
What is the amino acid sequence in the portion of the protein molecule coded for by the piece of mRNA shown in the diagram?
A. Ser-Tyr-Arg-GlyB.Leu-Lys-Cys-PheC.Val-Asp-Pro-HisD.Pro-Glu-Leu-Val