1. Jeopardy Final Jeopardy Topic 1 Topic 2 Topic 3 Topic 4 Topic 5 $100
$200
$200
$200
$200
$200
$300
$300
$300
$300
$300
$400
$400
$400
$400
$400
$500
$500
$500
$500
$500
Final Jeopardy

2. 1 - $100
The process of making an organism that is genetically identical to another is _________?
Cloning

3. 1 - $200 How is evidence of a crime scene matched to a suspect?
DNA fingerprinting- match the patterns

4. 1 - $300
How can an inspector make copies of only a very small amount of DNA?
Polymerase Chain Reaction (PCR)

5. 1 - $400
When creating recombinant DNA, why is it important to only use ONE restriction enzyme?
It ensures that the “sticky ends” are complementary to each other.

6. 1 - $500 Explain one cycle of PCR- 3 steps DNA strands separate
Primers attach to DNA
- DNA polymerase adds complementary nucleotides

7. 2 - $100
A transgenic organism is also known as a ?
GMO

8. 2 - $200
Does a DNA fingerprint look like a finger fingerprint? Why or why not?
No! A DNA fingerprint is fragments of unique DNA and a finger fingerprint is a physical pattern.

9. 2 - $300
When an electrical current pulls DNA through a gel is called ?
Gel electrophoresis

10. 2 - $400
DNA fragments cut by a restriction enzyme can pair up and join with any other DNA fragments cut by the same ?
Restriction enzyme

11. 2 - $500
When producing recombinant DNA in bacteria, genes can be inserted into a ring of DNA known as ?
Plasmid

12. 3 - $100
Enzymes that cut DNA molecules at specific places are called ?
Restriction Enzymes

13. 3 - $200
__________ is the process of creating an individual who is an exact copy of an exisiting organism.
Cloning

14. 3 - $300
The use of genetic engineering to transfer human genes into bacteria allows the bacteria to produce human ?
Protein

15. 3 - $400
Crops that have the gene Bacillus thuringiensis added produce ?
A toxin that kills insects

16. 3 - $500
What is a common way for drug companies to make insulin for diabetics?
Insert the gene for insulin production into bacteria and use the insulin they make.

17. 4 - $100
Strand of DNA formed by combining DNA from two different species is called ?
Recombinant DNA

18. 4 - $200
Give some examples of good sources of DNA that could be collected at a crime scene.
Blood, a drinking cup, hair…..

19. 4 - $300
In gel electrophoresis shorter fragments move ____________________
Move farther than longer fragments

20. 4 - $400
Why are restriction enzymes used when creating a DNA fingerprint- what do they do?
They cut the DNA into small pieces that can be separated into distinct patterns.

21. 4 - $500 What are 3 true statements about stem cells?
Their use is controversial
They can replace diseased or damaged tissue
They can grow into a variety of different cell types.

22. 5 - $100
_____________ is the deliberate alteration of an organism’s genetic information.
Genetic Engineering

23. 5 - $200
DNA that is a combination of genetic information from 2 different organisms is called ?
Recombinant DNA

24. 5 - $300
When there is only a small amount of DNA found at a crime scene, billions of copies of the DNA can be made using ?
PCR

25. 5 - $400
If a restriction enzyme recognizes the sequence AAGG then cuts between A and G, how many cuts would be made in this strand of DNA?
GCTTAAAGGCCGGTATACCAAGGTACGTACGAAGG 3

26. 5 - $500 What are the 4 steps of cloning? 1- remove egg from female
2- DNA from individual to be cloned is put in egg cell
3-Embryo is placed in surrogate mother
4- Surrogate mother give birth to identical offspring

27. Final Jeopardy Type question to appear here
Type answer to appear with a mouse-click here