1. Chapter 12: Molecular Genetics

2. 10/27/16 Warm Up Transcribe this original DNA code to mRNA:
ATCGCATCCATCTTAGCCAGG
Translate this mRNA code to tRNA anticode:
AUUCGAUAGCGGACCUGAUUA

4. Warm Up 10/26/16 Where is DNA located in the cell?
Why is this a problem for protein synthesis?

5. On separate sheet of paper, put correct answer
You can either tell me why the new answer is correct OR
You can tell me why you thought you were right the first time and got it wrong.

6. Nucleotide

7. Nucleotides DNA contains RNA contains sugar deoxyribose a phosphate
4 nitrogenous bases: A, G, T, C
RNA contains
Ribose sugar
A phosphate
4 bases: A, G, U, C

8. DNA Nucleotides

9. DNA Nucleotide Base Pairing

10. DNA Structure Twisted ladder Deoxyribose and phosphate are rails
Rungs are base pairs (AT/CG)

11. Orientation DNA is antiparallel. Strand on the top runs from 5’ to 3’
The strand on the bottom runs in the opposite direction and is oriented 3' to 5'.

12. Chromosome Structure Prokaryotes: DNA in cytoplasm
Eukaryotes: DNA is in chromosomes

13. Semiconservative Replication
DNA parents strand separates
Uses one side to make new DNA, “conserves” the other
SEMICONSERVATIVE REPLICATION -parental strands of DNA separate, serve as templates, and produce DNA molecules that have one strand of parental DNA and one strand of new DNA
DNA replication occurs during interphase of mitosis and meiosis.
This process of semiconservative replication occurs in three main stages: unwinding, base pairing, and joining.

14. Unwinding DNA Helicase:
enzyme
unwinds and unzips double helix.
Leaves singles strands of DNA
RNA primase adds small section of RNA on each strand as a “primer”

15. Base Pairing DNA POLYMERASE: ensures the right nucleotides are paired.
A binds to T; C binds to G.
This allows identical copies of the DNA to be produced.

16. Comparing Nucleic Acids
DNA
RNA
2 strands (double helix)
1 strand
deoxyribose sugar
ribose sugar
A-T
A-U
G-C
stays in nucleus
can be found in nucleus and cytoplasm

17. RNA RNA (ribonucleic acid): contains the sugar ribose,
the base uracil, and
is single-stranded.

18. RNA
Types of RNA
Messenger RNA (mRNA): travels from nucleus to ribosome to direct the synthesis of a specific protein.
Ribosomal RNA (rRNA) - associates with proteins to form ribosomes
transfer RNA (tRNA) - transport amino acids to the ribosomes

19. Transcription Transcription - synthesis of mRNA from DNA
DNA converted to mRNA in nucleus.
The mRNA takes code to cytoplasm for protein synthesis.

20. Transcription Uracil replaces thymine as the mRNA molecule is made.
New mRNA moves out of nucleus through nuclear pores into cytoplasm.

21. Transcription

22. The Code Three-base code in DNA or mRNA is called a CODON.
Each of the three bases of a codon in the DNA is transcribed into the mRNA code.
Some codons are STOP codes, one is a START code.

23. Translation
Once the mRNA is synthesized and processed, it moves to the ribosome.
mRNA connects to ribosome
The code is read and translated
In translation, tRNA molecules act as interpreters of mRNA codons.

24. Translation