Presentation is loading. Please wait.

Presentation is loading. Please wait.

A B C Liao et al. Supplementary Figure 1

Published byAurore Ricard Modified over 6 years ago

Similar presentations

Presentation on theme: "A B C Liao et al. Supplementary Figure 1"— Presentation transcript:

1 A B C Liao et al. Supplementary Figure 1
hPRLR GAPDH 236bp 87bp LNCaP T47D A mGhr Gapdh 200bp 125bp C2C12 B6 placenta B6 liver B mPrlr Gapdh 202bp 125bp C2C12 B6 liver B6 placenta C Liao et al. Supplementary Figure 1 Semi-quantitative RT-PCR: A. Expression of the human prolactin receptor (hPRLR ) in the prostate cancer cell line, LNCaP, and the breast cancer cell line T47D. B. Expression of the mouse growth hormone receptor (mGhr) and C. the mouse prolactin receptor (mPrlr ) in mouse C2C12 cells, compared with RNA isolated from C57BL/6J (B6) liver and placenta. Gapdh was used as a loading control. Methodology: Total RNA was isolated using TRIzol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). Semi-quantitative RT-PCR was performed using a SYBR FAST One-Step qRT-PCR Kit (KAPA). Sequences of the nucleotide primers were: mGhr 5’-GCTACTCTTGGCAAAGCTTC and 5’-CGTTGGCTTT CCCTTTTAGC (35 cycles); hPRLR 5'- TTTGCCTCCAGCAAGGAACA and 5’-CGCGAACGGTCGGTAAAATC (28 cycles); mPrlr 5'-TTTTGCACATGAACC CTGAA and 5’-ACCAGCAGGTGAATGTTTCC (30 cycles); hGAPDH 5’-TGCACCACCAACTGCTTAGC and 5’-CCCATGGACTGTGGTCATGAC (24 cycles); and mGapdh 5’-CTTTGGCATTGTGGAAGGGC and 5’-CAGGGATGA TGTTCTGGGCA (24 cycles). Amplified RT-PCR products were visualised on a 1.5% agarose gel.

Download ppt "A B C Liao et al. Supplementary Figure 1"

Similar presentations

DETECTION OF DIFFERENT PROSTATE SPECIFIC MEMBRANE ANTIGEN mRNAs IN LYMPH NODES OF PROSTATE CANCER PATIENTS Ulrike Fiedler, Romy Kranz, Jana Scholze, Andreas.

DETECTION OF DIFFERENT PROSTATE SPECIFIC MEMBRANE ANTIGEN mRNAs IN LYMPH NODES OF PROSTATE CANCER PATIENTS Ulrike Fiedler, Romy Kranz, Jana Scholze, Andreas.
ER  HSP90 DMSO 200  M I3C30  M DIM200  M TRYPTOPHOL Supplemental Figure 1. DIM and Tryptophol fail to induce the downregulation of ER  seen with I3C.

ER  HSP90 DMSO 200  M I3C30  M DIM200  M TRYPTOPHOL Supplemental Figure 1. DIM and Tryptophol fail to induce the downregulation of ER  seen with I3C.
Chapter 08 Author: Kelly Elkins © 2013 Elsevier, Inc. All rights reserved.

Chapter 08 Author: Kelly Elkins © 2013 Elsevier, Inc. All rights reserved.
Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.
Supplemental Table 1 Source and authentication of cell lines.

Supplemental Table 1 Source and authentication of cell lines.
Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was.

Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was.
Relationship Between STAT3 Inhibition and the Presence of p53 on Cyclin D1 Gene Expression in Human Breast Cancer Cell Lines Introduction STAT3 and p53.

Relationship Between STAT3 Inhibition and the Presence of p53 on Cyclin D1 Gene Expression in Human Breast Cancer Cell Lines Introduction STAT3 and p53.
Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29.

Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29.
Wu et al., Supplementary Fig 1 Supplementary Figure 1: The depletion of BRG1 in HeLa cells has no effect on cell proliferation. Sh- empty vector was used.

Wu et al., Supplementary Fig 1 Supplementary Figure 1: The depletion of BRG1 in HeLa cells has no effect on cell proliferation. Sh- empty vector was used.
Invest. Ophthalmol. Vis. Sci ;45(6): doi: /iovs Figure Legend:

Invest. Ophthalmol. Vis. Sci ;45(6): doi: /iovs Figure Legend:
Rupp et al. Supplementary Figure 1: Structure of the human troponin T gene Exon 6 Genomic DNA cDNA from mRNA mutation Exon 9 Exon 10 302bp Parts of genomic.

Rupp et al. Supplementary Figure 1: Structure of the human troponin T gene Exon 6 Genomic DNA cDNA from mRNA mutation Exon 9 Exon bp Parts of genomic.
Butler et al Supplementary Figure 1 A B C D - E BL21

Butler et al Supplementary Figure 1 A B C D - E BL21
Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.
Figure 1. Analysis of four different hPRLR mRNA isoforms (L, I, S1a, and S1b) in human breast adipose tissue (Breast AT), sc abdominal.

Figure 1. Analysis of four different hPRLR mRNA isoforms (L, I, S1a, and S1b) in human breast adipose tissue (Breast AT), sc abdominal.
Suppression by an h Current of Spontaneous Na+ Action Potentials in Human Cone and Rod Photoreceptors Invest. Ophthalmol. Vis. Sci.. 2005;46(1):390-397.

Suppression by an h Current of Spontaneous Na+ Action Potentials in Human Cone and Rod Photoreceptors Invest. Ophthalmol. Vis. Sci ;46(1):
From: Crosstalk Between Transforming Growth Factor Beta-2 and Toll-Like Receptor 4 in the Trabecular Meshwork Invest. Ophthalmol. Vis. Sci.. 2017;58(3):1811-1823.

From: Crosstalk Between Transforming Growth Factor Beta-2 and Toll-Like Receptor 4 in the Trabecular Meshwork Invest. Ophthalmol. Vis. Sci ;58(3):
Htr-9 stimulates ICAM-1 gene expression in human ASM cells.

Htr-9 stimulates ICAM-1 gene expression in human ASM cells.
Supplementary FigureS4 (Feduska et al.)

Supplementary FigureS4 (Feduska et al.)
by Karen Reue, Robert D. Cohen, and Michael C. Schotz

by Karen Reue, Robert D. Cohen, and Michael C. Schotz
© 2013 Elsevier, Inc. All rights reserved.

© 2013 Elsevier, Inc. All rights reserved.

Similar presentations

Ads by Google