Presentation is loading. Please wait.

Presentation is loading. Please wait.

A B C Liao et al. Supplementary Figure 1

Similar presentations


Presentation on theme: "A B C Liao et al. Supplementary Figure 1"— Presentation transcript:

1 A B C Liao et al. Supplementary Figure 1
hPRLR GAPDH 236bp 87bp LNCaP T47D A mGhr Gapdh 200bp 125bp C2C12 B6 placenta B6 liver B mPrlr Gapdh 202bp 125bp C2C12 B6 liver B6 placenta C Liao et al. Supplementary Figure 1 Semi-quantitative RT-PCR: A. Expression of the human prolactin receptor (hPRLR ) in the prostate cancer cell line, LNCaP, and the breast cancer cell line T47D. B. Expression of the mouse growth hormone receptor (mGhr) and C. the mouse prolactin receptor (mPrlr ) in mouse C2C12 cells, compared with RNA isolated from C57BL/6J (B6) liver and placenta. Gapdh was used as a loading control. Methodology: Total RNA was isolated using TRIzol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). Semi-quantitative RT-PCR was performed using a SYBR FAST One-Step qRT-PCR Kit (KAPA). Sequences of the nucleotide primers were: mGhr 5’-GCTACTCTTGGCAAAGCTTC and 5’-CGTTGGCTTT CCCTTTTAGC (35 cycles); hPRLR 5'- TTTGCCTCCAGCAAGGAACA and 5’-CGCGAACGGTCGGTAAAATC (28 cycles); mPrlr 5'-TTTTGCACATGAACC CTGAA and 5’-ACCAGCAGGTGAATGTTTCC (30 cycles); hGAPDH 5’-TGCACCACCAACTGCTTAGC and 5’-CCCATGGACTGTGGTCATGAC (24 cycles); and mGapdh 5’-CTTTGGCATTGTGGAAGGGC and 5’-CAGGGATGA TGTTCTGGGCA (24 cycles). Amplified RT-PCR products were visualised on a 1.5% agarose gel.


Download ppt "A B C Liao et al. Supplementary Figure 1"

Similar presentations


Ads by Google