Genomics Part 1

Human Genome Project  G oal is to identify the DNA sequence of every gene in humans Genome  all the DNA in one cell of an organism  Will provide scientists with an encyclopedia of information and a better understanding of humans

Genomes That Have Been Sequenced RNA virus MS2 – (1976) DNA virus fX174 – 5368 base pairs (bp) (1977) Bacterium H. influenzae – 1.8 million bp (1985) Yeast S. cerevisiae (first eukaryote) – 12 million bp (1997) Fruit fly – 130 million bp (2000) First plant (Arabidopsis thaliana) – 120 million bp (2000) Human – 3 billion bp. “Working draft” announced % complete, 2003; complete DNA of a single individual (2007). Other animals: dog, horse, cat, mouse, chimpanzee, rat, chicken, pufferfish, mosquito, and many more Now about 900 genomes have been sequenced.

Sequencing the genomes of many organisms: Provides information to help understand many aspects of biology Can help us understand human genes, which are usually similar to genes in other organisms Provides information on evolution

Sequencing DNA Various methods have been used over the years. Some newer methods involve copying the DNA to give pieces of different lengths, with the last nucleotide having a fluorescent nucleotide that is a different color for each base. When the pieces are separated by size, reading the sequence of colors gives the sequence of the DNA.

Dideoxy chain-termination method for sequencing DNA Figure DNA (template strand) Primer Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) TGTTTGTT 3 5 DNA polymerase CTGACTTCGACAACTGACTTCGACAA PPPPPP dATP dCTP dTTP dGTP G OH ddATP ddCTP ddTTP ddGTP G H CTGACTTCGACAACTGACTTCGACAA ddC T G T ddG C T G T ddA G C T G T ddA A G C T G T ddG A G C T G T ddT G A G C T G T ddC T G A G C T G T ddA C T G A G C T G T ddG A C T G A G C T G T 3 DNA (template strand) Labeled strands Direction of movement of strands LaserDetector APPLICATION The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. TECHNIQUE This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3’—OH group, the site for attachment of the next nucleotide (see Figure 16.12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. RESULTS The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.) GACTGAAGCGACTGAAGC

Sequencing DNA An automated sequencing machine can analyze about 1000 samples in a day, determining sequences of 300 to 1000 bp for each. The cost of sequencing per nucleotide has dropped steadily, from about $10 per bp in 1990 to about 1/10 of a cent per bp today. In the future it is expected to drop even more, allowing affordable sequencing of individual genomes.

Two Strategies for Genome Sequencing Method 1: use genetics to find the locations of many genes on the chromosomes; cut chromosomes into pieces containing these genes; sequence small pieces; assemble the sequences

Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) Genetic (linkage) mapping Ordering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) Physical mapping Ordering of large over- lapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the com- plete genome sequence Chromosome bands Genes located by FISH Genetic markers Overlapping fragments …GACTTCATCGGTATCGAACT… Method 1

Two Strategies for Genome Sequencing Method 2: “Shotgun” approach: entire chromosome is cut into random pieces; the pieces are sequenced; computer programs then assemble the resulting very large number of overlapping short sequences into a single continuous sequence. Two rival groups used these different strategies in sequencing the human genome.

Cut the DNA from many copies of an entire chromosome into overlapping frag- ments short enough for sequencing. Clone the fragments in plasmid or phage vectors Sequence each fragment Order the sequences into one overall sequence with computer software. ACGATACTGGT CGCCATCAGTACGATACTGGT AGTCCGCTATACGA …ATCGCCATCAGTCCGCTATACGATACTGGTCAA… Method 2

About 3 billion bp Current estimates are that the human genome contains about 25,000 genes Only 1.5% of the genome codes for genes. The rest is involved in regulation, or is “junk.” The number of genes is not much different than in many other “simpler” organisms. The Human Genome

Genome sequences provide clues to important biological questions In genomics: scientists study whole sets of genes and their interactions Computer analysis of genome sequences helps researchers identify sequences that are likely to encode proteins Comparison of the sequences of “new” genes with those of known genes in other species may help identify new genes