1. A Lot More Advanced Biotechnology Tools
Sequencing

2. DNA Sequencing Sanger method determine the base sequence of DNA
based on replication
dideoxynucleotides
ddATP, ddGTP, ddTTP, ddCTP
missing O for bonding of next nucleotide
terminates the growing chain

3. DNA Sequencing Sanger method1
Sanger method
synthesize complementary DNA strand in vitro
in each tube:
“normal” N-bases
dideoxy N-bases
ddA, ddC, ddG, ddT
DNA polymerase
primer
buffers & salt 2 3 4 2

4. Reading the sequence
Load gel with sequences from ddA, ddT, ddC, ddG in separate lanes
read lanes manually & carefully
polyacrylamide gel

5. Fred Sanger 1978 | 1980 This was his 2nd Nobel Prize!!
1st was in 1958 for the structure of insulin

6. Advancements to sequencing
Fluorescent tagging
no more radioactivity
all 4 bases in 1 lane
each base a different color
Automated reading

7. Advancements to sequencing
Fluorescent tagging sequence data
Computer read & analyzed

8. Advancements to sequencing
Capillary tube electrophoresis
no more pouring gels
higher capacity & faster
Applied Biosystems, Inc (ABI) built an industry on these machines
384 lanes

9. Big labs! economy of scale PUBLIC Joint Genome Institute (DOE) MIT
Washington University of St. Louis
Baylor College of Medicine
Sanger Center (UK)
PRIVATE
Celera Genomics
Celera: Rockville, MD & San Francisco, CA
Baylor: Houston TX

10. Automated Sequencing machines
Really BIG labs!

11. Human Genome Project U.S government project Celera Genomics
begun in 1990
estimated to be a 15 year project
DOE & NIH
initiated by Jim Watson
led by Francis Collins
goal was to sequence entire human genome
3 billion base pairs
Celera Genomics
Craig Venter challenged gov’t
would do it faster, cheaper
private company
build the technology groundwork
improve sequencing methods
build clones
build better data management systems (computer tools to find overlaps)
better, cheaper, faster!
painstaking sequencing work
1998
Celera genomics challenge
2000
rough draft of human genome (90% sequence, 99% accurate)
2001
1st draft of human genome
2003
“finished” sequence of human genome
can’t sequence telomeres & centromeres

12. Different approaches “map-based method” “shotgun method” gov’t method
Craig Venter’s method
1. Cut DNA entire chromosome into small fragments and clone.
2. Sequence each segment & arrange based on overlapping nucleotide sequences.
Cut DNA segment into fragments, arrange based on overlapping nucleotide sequences, and clone fragments.
2. Cut and clone into smaller fragments.
3. Assemble DNA sequence
using overlapping sequences.

13. Human Genome Project
On June 26, 2001, HGP published the “working draft” of the DNA sequence of the human genome.
Historic Event!
blueprint of a human
the potential to change science & medicine

14. Sequence of 46 Human Chromosomes
3G of data
3 billion base pairs

15. human genome 3.2 billion bases
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome 3.2 billion bases

16. Raw genome data

17. NCBI GenBank Database of genetic sequences gathered from research
Publicly available on Web!

18. Organizing the data

19. Maps of human genes… Where the genes are…
mapping genes & their mutant alleles

20. Defining a gene…
“Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.”
– Elizabeth Pennisi, Science 2003
protein
gene
RNA
gene
1990s -- thought humans had 100,000 genes
,000 was considered a good estimate
,000
,000 is our best estimate
gene
polypeptide 1
polypeptide 2
polypeptide 3

21. How does the human genome stack up?
Organism
Genome Size (bases)
Estimated Genes
Human (Homo sapiens)
3 billion
30,000
Laboratory mouse (M. musculus)
2.6 billion
Mustard weed (A. thaliana)
100 million
25,000
Roundworm (C. elegans)
97 million
19,000
Fruit fly (D. melanogaster)
137 million
13,000
Yeast (S. cerevisiae)
12.1 million
6,000
Bacterium (E. coli)
4.6 million
3,200
Human Immunodeficiency Virus (HIV)
9700 9