This seems highly unlikely. Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to be discovered. This seems highly unlikely. —F. Crick (1958)
Contents Basics RNA structure Prediction RNA structure in biology RNA efferencing
Cell Source: “Molecular Cell Biology” by Lodish et al.
Source: “Biology” by Campbell & Reece
Cellular macromolecules Source: “Molecular Cell Biology” by Lodish et al.
All nucleotides have a common structure Source: “Molecular Cell Biology” by Lodish et al.
There are five principal bases in nucleic acids A, G, T, C are present in DNA A, G, U, C are present in RNA Source: “Molecular Cell Biology” by Lodish et al.
Nucleotide subunits are linked together by phosphodiester bonds Source: “Molecular Cell Biology” by Lodish et al.
Nucleotide terminology Source: “Molecular Cell Biology” by Lodish et al.
Native DNA is a double helix of complementary anti-parallel chains Hydrogen bonding between complementary base pairs (A-T or G-C) holds the two strands together Source: “Molecular Cell Biology” by Lodish et al.
DNA can undergo reversible strand separation Source: “Molecular Cell Biology” by Lodish et al.
Source: “Biology” by Campbell & Reece
Source: “Molecular Cell Biology” by Lodish et al.
Contents Basics RNA structure Prediction RNA 2nd structure in biology RNA efferencing
Complementary sequences in RNA molecules maintain RNA secondary structure. Source: “Bioinformatics” by David W. Mount
Features of RNA Secondary Structure In DNA, G≡C A＝T In RNA, G≡C A＝U G＝U
Features of RNA Secondary Structure Primary structure ↓ Secondary Structure Tertiary Structure
Types of single- & double-stranded regions in RNA secondary structures. Source: “Bioinformatics” by David W. Mount
Interaction of RNA secondary structural elements. Source: “Bioinformatics” by David W. Mount
Display of base pairs in an RNA secondary structure by a circle plot. Source: “Bioinformatics” by David W. Mount
Contents Basics RNA structure Prediction RNA structure in biology RNA efferencing
Prediction Minimum Free-Energy Method Sequence Co-variation
Global alignment L G P S S K Q T G K G S – S R I W D N | | | | | | | | | | | | | | L N – I T K S A G K G A I M R L G D A Local alignment - - - - - - - - T G K G - - - - - - - | | | - - - - - - - - A G K G - - - - - - - Adapted from “Bioinformatics” by D W Mount
Dotplot DOROTHY--------HODGKIN DOROTHYCROWFOOTHODGKIN Adapted from “Introduction to Bioinformatics“ by A M Lesk
Drosophila melanogaster SLIT protein against itself http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html
Dotplot A G C T A G G A | | | | | C A C T A G G C
5’ A C G U - - - - G C G U 3’ | | | | 3’ U G C G - - - - U G C A 5’
Source: “Bioinformatics” by David W. Mount
Source: “Bioinformatics” by David W. Mount
RNA 2nd Structure Website http://www.bioinfo.rpi.edu/~zukerm/rna/
Prediction Minimum Free-Energy Method Sequence Co-variation
Source: “Bioinformatics” by David W. Mount
Source: “Bioinformatics” by David W. Mount
RNA 2nd Structure Website http://www.genebee.msu.su/services/rna2_reduced.html
1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC---- 2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA 3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA
1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC---- 2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA 3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA
Limitations of Prediction-Assumption The most likely structure is similar to the energetically most stable structure. The energy associated with any position in the structure is only influenced by local sequence and structure. The structure is assumed to be formed by folding of the chain back on itself in a manner that does not produce any knots. Source: “Bioinformatics” by David W. Mount
Contents Basics RNA structure Prediction RNA structure in biology RNA efferencing
RNA 2nd structure in Biology Nuclear RNA splicing Group I/II intron splicing Ribosome RNA sensor
Processing of eukaryotic mRNA Source: “Molecular Cell Biology” by Lodish et al.
Source: “Molecular Cell Biology” by Lodish et al.
Source: “Gene VII” by Lewin
Interaction of the RNP motif from U1A protein and RNA Figure 11-10 Source: “Molecular Cell Biology” by Lodish et al.
hnRNP proteins may assist in processing and transport of mRNAs Figure 11-11 Source: “Molecular Cell Biology” by Lodish et al.
Splicing occurs at short, conserved sequences Consensus sequences around 5 and 3 splice sites in vertebrate pre-mRNA Figure 11-14 Source: “Molecular Cell Biology” by Lodish et al.
Splicing proceeds via two sequential transesterfication reactions Figure 11-16 Source: “Molecular Cell Biology” by Lodish et al.
Small nuclear RNAs (snRNAs) assist in the splicing reaction Figure 11-17 Source: “Molecular Cell Biology” by Lodish et al.
Spliceosomal splicing cycle Figure 11-19 Source: “Molecular Cell Biology” by Lodish et al.
Source: “Gene VII” by Lewin
Self-splicing group II introns provide clues to the evolution of snRNPs Figure 11-20 Source: “Molecular Cell Biology” by Lodish et al.
RNA 2nd structure in Biology Nuclear RNA splicing Group I/II intron splicing Ribosome RNA sensor
Self-splicing group I introns were the first examples of catalytic RNA Figure 11-51 Source: “Molecular Cell Biology” by Lodish et al.
A Preorganized Active Site in the Crystal Structure of the Tetrahymena Ribozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R. Cech* Science 282, 259~264 (1998)
The ribozyme core is formed by the junction of four helices
The model for P1’s interaction with the ribozyme juxtaposes the guanosine-binding site Source: “Molecular Cell Biology” by Lodish et al.
Source: “Gene VII” by Lewin
Source: “Gene VII” by Lewin
RNA 2nd structure in Biology Nuclear RNA splicing Group I/II intron splicing Ribosome RNA sensor
Source: “Gene VII” by Lewin
Source: “Gene VII” by Lewin
Source: “Gene VII” by Lewin
The Structural Basis of Ribosome Activity in Peptide Bond Synthesis Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter B. Moore and Thomas A. Steitz Nature (2000) 289, 920~930
The ribosome is a ribozyme.
RNA 2nd structure in Biology Nuclear RNA splicing Group I/II intron splicing Ribosome RNA sensor
Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression Wade Winkler*, Ali Nahvi† & Ronald R. Breaker* Nature (2002) 419, 952~956.
http://rfam.wustl.edu/
Sequence Alignment Scoring versus Structural Alignment Scoring Cell, 109, 137–140, 2002
http://www.imb-jena.de/RNA.html
Contents Basics RNA structure Prediction RNA structure in biology RNA efferencing
2,431 pairs of sense–antisense transcripts overlapping in the exons of the sense gene by at least 20 bases. NATURE VOL 420 (2002) p563
A model for the molecular steps in RNA silencing. Science 296:p1263, 2002
Science 296:p1260, 2002
Science 296:p1260, 2002
EMBO Report 2:p986, 2001