Wildlife Forensics Environmental Study Center

Chinchilla

Chinchilla Habitat

Products made from chinchilla fur

Video Clip

Gel Electrophoresis

DNA Technology

Activity #2 – Preparing Gels

Preparing the Gel Set up the tray by firmly attaching the rubber stoppers to either end. Place the well template at one end. Set aside.

Preparing the Gel Use the heat gloves to obtain a small flask of agarose gel in liquid form from the water bath. CAUTION – Use gloves, the glass is hot. Carefully pour the gel into the prepared tray; the gel should not be above the top of the rubber stoppers. Let cool for about 20 minutes or until the gel completely solidifies. Set the gel aside to practice pipetting.

Activity #2 – Pipette Practice

Practice Pipetting Gather your materials: micropipette, clean tips, garbage container, cup of water, gel with practice wells, gel electrophoresis kit Hold the pipette correctly in your hand against your palm with your thumb on the trigger. Set the correct volume by setting the knob to 35 μl. Never go less than 10 μl or greater than 90 μl. Select a new tip for the micropipette, each tip is only used once. Firmly attach the tip without touching the tips with your fingers.

Practice Pipetting Press the top button with your thumb until you feel the first bit stop. Keep your thumb in that position and place the tip in the liquid. Release the button and the micropipette will pull the liquid into the tip. Carefully place the tip of the micropipette in the designated well and press down to the second stop. Do not release the button until the micropipette is out of the well.

Practice Pipetting Press the ejector button to discard the tip into the garbage container. Repeat 3-4 times until your feel confident with the movements. Make sure each person in the group is confident.

Restriction Enzyme Cut after AGT CTCACGTCGAGTCTCAACCGTT CTCACGTCGAGT|CTCAACCGTT CTCACGTCGAGT CTCAACCGTT

Restriction Enzyme Practice Directions: Label your construction paper 1, 2, 3, 4. Cut out each strand individually and be careful not to mix up the strands. Cut each strand after a sequence of AGT, that is the restriction enzyme we are using. Line up the pieces from largest to smallest. If two pieces are the same number of base pairs long, tape them together. Which 2 strands are the same?

Running Gel Electrophoresis

Running Gel Electrophesis Wild chinchilla 1 Wild chinchilla 2 Domesticated chinchilla Domesticated chinchilla 2 Unknown fur sample 1 Unknown fur sample 2

Running Gel Electrophoresis Load your gels at the negative end because DNA is negative and will move toward the positive end. Use your new pipette skills to carefully transfer each DNA sample into the appropriate well. Take care to gently add the DNA to each well and remember to use a NEW tip for each transfer Cover the gels with buffer solution and place the lid on top. Make sure both groups at the table are ready and connect gel electrophoresis machine to power source and turn on.

Running Gel Electrophoresis Run the electrophoresis for 20 minutes at a voltage of 125 V. Clean up your station while the gel is running. Give the students the time to set up and run their gel, students will have the protocol sheet with all of this information. After 20 minutes disconnect the electricity and remove the lid. Students should carefully remove the gel and sketch what they see, making sure to label each lane.