Protein Synthesis IB Biology HL 1 Spring 2014 Mrs. Peters

Review- What do we know? What is the function of the nucleus? What is the function of the nucleus? What is the function of a ribosome? What is the function of a ribosome? What are the types of ribosomes? What are the types of ribosomes? What are the components of nucleotides? What are the components of nucleotides? What is complementary base pairing? What is complementary base pairing?

Important Information DNA: found in the nucleus, contains all the genetic information needed to function and survive DNA: found in the nucleus, contains all the genetic information needed to function and survive Gene: a segment of DNA that codes for a specific protein Gene: a segment of DNA that codes for a specific protein DNA Structure: DNA Structure: Two separate strands twisted together (double helix) containing: Two separate strands twisted together (double helix) containing: Nitrogen Bases: A,T,C,G Nitrogen Bases: A,T,C,G Back bone (side): alternating deoxyribose and phosphate groups Back bone (side): alternating deoxyribose and phosphate groups Protein Synthesis: the process to make a protein Protein Synthesis: the process to make a protein

RNA (Ribonucleic Acid) Single Strand Single Strand Nucleotides made up of ribose, phosphate and nitrogen base Nucleotides made up of ribose, phosphate and nitrogen base Nitrogen Bases: A, C, G, U (uracil, no T) Nitrogen Bases: A, C, G, U (uracil, no T) Three types: Three types: mRNA: messenger RNA tRNA: transfer RNA rRNA: ribosomal RNA

DNA vs. RNA FeatureDNARNA StrandDoubleSingle SugarDeoxyriboseRibose Nitrogen bases A, T, C, G, A, U, C, G Location Nucleus ONLY Nucleus and Cytoplasm

DNA Strands Only one DNA strand is used during protein synthesis. Sense Strand: the strand that has the same base sequence as the RNA molecule, also known as the complementary strand (5’-3’ strand of DNA) Sense Strand: the strand that has the same base sequence as the RNA molecule, also known as the complementary strand (5’-3’ strand of DNA) Antisense Strand: the strand that acts as the template for making the RNA molecule, RNA polymerase binds to this strand, also known as the template strand (3’-5’ strand of DNA) Antisense Strand: the strand that acts as the template for making the RNA molecule, RNA polymerase binds to this strand, also known as the template strand (3’-5’ strand of DNA) You ask, how do I remember this craziness? You ask, how do I remember this craziness? well it doesn’t make sense, so the antisense is the template. well it doesn’t make sense, so the antisense is the template.

Protein Synthesis Two parts: 1. Transcription: using DNA to create mRNA, takes place in nucleus 2. Translation: using mRNA to create proteins, takes place at ribosomes in cytoplasm or attached to RER End Result: A protein

Transcription Three parts 1. Initiation 2. Elongation 3. Termination

Transcription Part 1: Initiation 1. (enzyme) binds to the promoter region on DNA (TATAAAA) 1. RNA polymerase (enzyme) binds to the promoter region on DNA (TATAAAA) 2. DNA strands unwind 3. RNA polymerase initiates RNA synthesis at the start point on the antisense (template) strand

Transcription Part 2: Elongation 1. Free RNA nucleotides pair with complementary bases on antisense strand only 2. RNA polymerase forms covalent bonds between RNA nucleotides 3. RNA polymerase moves “downstream”, unwinding DNA and elongating the RNA transcript in the 5’-3’ 4. The RNA transcript created has the same base sequence as the sense strand 5. RNA polymerase checks the RNA strand to make sure bases pair correctly 6. DNA helix is rewound by RNA polymerase as the RNA strand is created (transcribed)

Transcription Part 3: Termination 1. RNA polymerase reaches and transcribes a terminator region (TTATTT), which signals the end of the transcription unit or gene. 2. The RNA transcript is released, and RNA polymerase detaches from the DNA molecule 3. DNA double helix reforms

Transcription Practice Write this DNA sequence (antisense strand) on your paper: ACGTATAAAACATAGGACTGACTGATTATT TATTTTGTATCCTGACTGACTAATAA TGCATATTTTGTATCCTGACTGACTAATAA UGC UAUUUUGUAUCCUGACUGACUAAUAA UGC AUAUUUUGUAUCCUGACUGACUAAUAA 1. Write the complementary sequence (sense strand) under it 2. Write the RNA transcript. (Hint: where does it start?)

Important Information Codon: a series of three nitrogen bases (sometimes referred to as a triplet code) Codon: a series of three nitrogen bases (sometimes referred to as a triplet code) Can be 3 DNA or 3 mRNA bases Can be 3 DNA or 3 mRNA bases Code for a specific amino acid Code for a specific amino acid Introns: non-coding segments of transcribed RNA that intervene with the coding sequence Introns: non-coding segments of transcribed RNA that intervene with the coding sequence Exons: segments of transcribed RNA sequences to be expressed Exons: segments of transcribed RNA sequences to be expressed

RNA Processing Happens in the nucleus after transcription to form mRNA 1. Enzymes modify the two ends of the RNA transcript (pre-mRNA) molecule 2. Introns are removed, exons are spliced together 3. mRNA leaves the nucleus, enters cytoplasm to find ribosome

mRNA Structure 5’ cap at the beginning 5’ cap at the beginning Start Codon: codon that starts the translation process (AUG) Start Codon: codon that starts the translation process (AUG) Coding segments: segments of bases that code for the protein to be made Coding segments: segments of bases that code for the protein to be made Stop Codon: codon that stops the translation process (3 types) Stop Codon: codon that stops the translation process (3 types) Poly-A tail at the end Poly-A tail at the end

tRNA Transfer RNA (tRNA) Function: to transfer amino acids from cytoplasm to ribosome Function: to transfer amino acids from cytoplasm to ribosome Structure: Structure: single strand of RNA which is folded and coiled on itself to look like a 2D clover leaf, with three loops single strand of RNA which is folded and coiled on itself to look like a 2D clover leaf, with three loops Amino acid attachment site at one end Amino acid attachment site at one end a nucleotide triplet code called an anticodon at the other end which is complementary to a mRNA codon a nucleotide triplet code called an anticodon at the other end which is complementary to a mRNA codon Each tRNA is unique to a specific amino acid based on the anticodon Each tRNA is unique to a specific amino acid based on the anticodon An enzyme attaches the correct amino acid to each tRNA An enzyme attaches the correct amino acid to each tRNA DRAW and LABEL a tRNA molecule DRAW and LABEL a tRNA molecule

Ribosome Structure: large and small subunit, made from proteins and ribosomal RNA (rRNA) Structure: large and small subunit, made from proteins and ribosomal RNA (rRNA) Subunits join to form functional ribosome when they attach to mRNA Subunits join to form functional ribosome when they attach to mRNA Has binding site for mRNA and 3 for tRNA Has binding site for mRNA and 3 for tRNA P site, A site, E site P site, A site, E site DRAW and LABEL a ribosome DRAW and LABEL a ribosome

Translation Four parts 1. Initiation 2. Elongation 3. Translocation 4. Termination

Translation Part 1 Initiation: 1. Small ribosomal subunit binds to mRNA 2. Initiator tRNA with anticodon UAC, pairs with start codon AUG, tRNA amino acid is methionine (Met) 3. Large ribosomal subunit attaches (requires energy for assembly) 4. Initiator tRNA is in the P site, A site is ready for next tRNA

Translation Part 2: Elongation 1. Codon Recognition: an incoming tRNA binds to the codon in A site 2. Peptide bond formation: the ribosome catalyzes the formation of a peptide bond between the new amino acid and the carboxyl end of the growing polypeptide

Translation Part 3: Translocation 1. the tRNA in the A site is moved to the P site, taking the mRNA along with it, A site open to next tRNA 2. The tRNA in the P site moves to the E site and is released from the ribosome, the ribosome shifts the mRNA by one codon

Translation Part 4: Termination 1. When the ribosome reaches the termination codon (UAG,UAA,UGA) on the mRNA, the A site of the ribosome accepts a protein called a release factor instead of tRNA

Translation Termination cont’d 2. The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain, the polypeptide is freed from the ribosome 2. The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain, the polypeptide is freed from the ribosome 3. The two ribosomal subunits and the other components dissociate

Translation Practice mRNA strand: UUUAUGCAUAUUUUGUAUCCUGACUCACUAUGA 1. Write the mRNA strand on your paper. 2. Underline the start codon, draw a line to between each codon 3. Write the anticodons for the tRNA molecules. 4. Write the amino acids the mRNA is coding for.

Ribosomes and Polysomes Polysome: a string of many ribosomes translating the same mRNA strand at the same time Polysome: a string of many ribosomes translating the same mRNA strand at the same time Free Ribosomes: synthesize proteins used within the cell Free Ribosomes: synthesize proteins used within the cell Attached Ribosomes: synthesize proteins for secretion (released by the cell) or for use in lysosomes. Attached Ribosomes: synthesize proteins for secretion (released by the cell) or for use in lysosomes.

Prokaryote Transcription RNA polymerase binds to a promoter region and adds nucleotides to form RNA RNA polymerase binds to a promoter region and adds nucleotides to form RNA RNA polymerase stops at a terminator site RNA polymerase stops at a terminator site RNA can be made in the 5’-3’ or 3’-5’ directions RNA can be made in the 5’-3’ or 3’-5’ directions mRNA is not processed, no introns, no 5’ cap and no poly-A tail mRNA is not processed, no introns, no 5’ cap and no poly-A tail Takes place in the cytoplasm Takes place in the cytoplasm Translation can happen while the mRNA is being transcribed. Translation can happen while the mRNA is being transcribed.

Protein Synthesis In your own words, write a description of what happens during protein synthesis. In your own words, write a description of what happens during protein synthesis. Must include: transcription, translation, DNA, RNA, mRNA, tRNA, codon, anticodon, amino acid, polypeptide chain, ribosome, codon, anticodon, nucleus, cytoplasm, antisense strand, sense strand Must include: transcription, translation, DNA, RNA, mRNA, tRNA, codon, anticodon, amino acid, polypeptide chain, ribosome, codon, anticodon, nucleus, cytoplasm, antisense strand, sense strand

Protein Synthesis Simulation Create a protein using a given DNA strand. Work in groups of 3 Each person in the group needs their own paper to turn in! Must have all parts completed and turned in by Friday, May 9