Replication Transcription Translation

Slides:

Advertisements

Similar presentations

Gene Expression and Control Part 2

Advertisements

Cell Division, Genetics, Molecular Biology

Molecular Genetics Ch. 16, 17, 18, 19, 20. DNA Replication Happens during interphase of mitosis. Semiconservative Replication 3 basic steps  Unwind and.

Protein Synthesis Jessica Hawley.

Biological Information Flow

From gene to protein. DNA:nucleotides are the monomers Proteins: amino acids are the monomers DNA:in the nucleus Proteins:synthesized in cytoplasm.

PROTEIN SYNTHESIS.

Making Proteins Cell Structure (80% of cell membrane is proteins) Transport Channels Cell Processing Hormones (signals) Enzymes What else?

8.4 DNA Transcription 8.5 Translation

DNA RNA Gene Expression.  DNA deoxyribonucleic acid ◦ Deoxribose sugar ◦ 2 strands held together with H bonds ◦ ATGC are the nitrogen bases ◦ Double.

Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.

Hemophilia- Caused by a defect in a single gene cannot produce all the proteins necessary for blood clotting Depend on expensive injections of clotting.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Protein Synthesis Using RNA to make proteins. Going from DNA to Proteins Let’s review what we’ve done so far: We take our DNA and convert it into RNA.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

CENTRAL DOGMA OF BIOLOGY. Transcription & Translation How do we make sense of the DNA message? Genotype to Phenotype.

FROM DNA TO PROTEIN Transcription – Translation. I. Overview Although DNA and the genes on it are responsible for inheritance, the day to day operations.

1 Gene expression Transcription and Translation. 2 1.Important Features: Eukaryotic cells a. DNA contains genetic template for proteins. b. DNA is found.

General Biology Notes TRANSLATION A.K.A. PROTEIN SYNTHESIS

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

A PuhJayJay Presentation. Daily Catalyst 1. If there are 34% of Adenines in DNA, what is the percentage of uracil in RNA? 34% 2. Replicate the following.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

{ DNA Deoxyribonucleic Acid. History What is passed on from parents to offspring? Protein or DNA? DNA! What is the structure, what does it look like?

12-3 RNA and Protein Synthesis

Chapter 7 Gene Expression and Control Part 2. Transcription: DNA to RNA  The same base-pairing rules that govern DNA replication also govern transcription.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

DNA replication DNA makes a copy of itself BEFORE the cell divides Transcription RNA is made by base pairing with a DNA template Translation mRNA templates.

RNA AND PROTEIN SYNTHESIS

Transcription & TranslationNovember , 2012 W ARM U P … What are the differences between DNA & RNA?

Gene Expression. Central Dogma Information flows from: DNA  RNA  Protein Exception: reverse transcriptase (retroviruses) RNA  DNA  RNA  Protein.

Mitosis and Protein Synthesis. Cell Division Occurs in humans and other organisms at different times in their life. Cell Division differs depending on.

DNA, RNA, and Protein Replication Transcription Translation.

Ch Gene  Protein A gene is a sequence of nucleotides that code for a polypeptide (protein) Hundreds-thousands of genes are on a typical chromosome.

Microbial Genetics.  DNA replication is semiconservative:  What does it mean? During cell division, each daughter cell inherits 2 DNA strands, One.

Nucleic Acids and Protein Synthesis. Nucleic Acids DNA DNA Deoxyribonucleic Acid Deoxyribonucleic Acid RNA RNA Ribonucleic Acid Ribonucleic Acid.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

Chapter 13 GENE FUNCTION. A. Comparison of DNA & RNA.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.

Powerpoint Templates.  Replication is semiconservative  Each strand is a template  Building starts at opposite ends (avoid friction of nucleotides)

Transcription, RNA Processing, & Translation

Section 20.2 Gene Expression

Inheritance and the Structure of DNA

Transcription, RNA Processing, & Translation

CENTRAL DOGMA OF BIOLOGY

Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.

Gene Expression Continued

Protein Synthesis.

Transcription and Translation

Protein Synthesis: Translation

Chp: 12 Transcription & Translation

Transcription & Translation.

Amino Acid Activation And Translation.

Chapter 8, part A Microbial Genetics.

Transcription Steps to Transcribe DNA:

Unit 7: Molecular Genetics

GENE EXPRESSION / PROTEIN SYNTHESIS

Translation: Protein Synthesis

Transcription Using DNA to make RNA.

DNA & Gene Expression Transcription & Translation

Chapter 8, part A Microbial Genetics.

Protein Synthesis.

Protein Synthesis.

Presentation transcript:

Replication Transcription Translation DNA, RNA, and Protein Replication Transcription Translation

Replication Occurs during S phase of cell cycle DNA unwinds, in increments, via helicase DNA polymerase makes 2 copies of DNA Complementary base pairing: G=C; T=A Leading strand has continuous replication Lagging strand done in Okazaki fragments Ligase joins segments on lagging strand

Making copies of DNA 5’TACCGACTTGATCATTTAGGTAGACATATT …3’ 3’ATGGCTGAACTAGTAAATCCATCTGTATAA …5’ DNA splits into leading (5’) & lagging (3’) strands Each strand does complementary base pairing. and 3’ATGGCTGAACTAGTAAATCCATCTGTATAA…5’

Transcription Makes RNA copy of DNA via RNA polymerase Makes mRNA, tRNA, or rRNA RNA polymerase binds to DNA promoter DNA strands unwind & separate RNA polymerase adds free RNA nucleotides to complement 1 strand of DNA bases. G =C; C=G; T=A; A=U RNA polymerase releases DNA & new RNA when reaches a termination signal.

Transcription & Translation DNA:5’TACCGACTTGATCATTTAGGTAGACAT…3’ mRNA:AUGGCUGAACUAGUAAAUCCAUCUGUA… mRNA exits nucleus after processing cap & tail mRNA on ribosome is translated via tRNAs. tRNA anticodons pair with mRNA codons (UAA, UAG, UGA). Each tRNA carries a specific amino acid or a stop signal. Genetic code is maintained universally. mRNA: AUGGCUGAACUAGUAAAUCCAUCUGUA polypeptide: met-ala-glt-leu-val-ast-pro-ser-val-

Translation Involves all 3 types of RNA: mRNA, tRNA, rRNA Produces polypeptides which form proteins Peptide bonds link amino acids together There are 20 essential amino acids found in all living things. Some have modifications. Amino acids form 1o, 2o & 3oprotein structures Structures are essential to protein function

Steps of Translation mRNA docks on ribosome. Its 1st codon is AUG tRNA with met binds via its anticodon UAC. tRNA with its amino binds to 2nd codon. Ribosome detaches met from 1st tRNA. Peptide bond forms between met & 2nd amino acid. First tRNA exits the ribosome & 3rd tRNA enters. Elongation continues until reaches stop codon Ribosome separates from mRNA with last tRNA Translation machinery then translates same or new mRNA

Human Genome The entire gene sequence of human DNA 3.2 billion base pairs in our 23 chromosomes Use computers to analyze DNA sequences Bioinformatics , a new field, compares these. Help predict loci of genes Don’t know yet what all 30,000 genes encode Field of proteomics links gene to protein made