What do genes look like?

I. Genes – segments of DNA that carry hereditary instructions and are passed from parent to offspring; genes are located on chromosomes

Chromosome Structure of Eukaryotes Section 12-2 Nucleosome Chromosome DNA double helix Coils Supercoils Histones Go to Section:

DNA – Hereditary material that controls all the activities of a cell and provides the instructions for making proteins DNA is made of nucleotides Nucleotides have three parts; 5-carbon sugar, phosphate group and a nitrogen base

Nucleotides are identical except for the nitrogen base A nucleotide can contain 1 of 4 Nitrogen Bases – Adenine Guanine Cytosine Thymine

Sugar Phosphate Group Nitrogen Base Can Be: Adenine Guanine Cytosine Thymine Sugar

3. The amount of Adenine = Thymine, Cytosine = Guanine (Chargaff’s Rule)

III. The Double Helix- 1953, 2 American scientists, Watson and Crick, discovered the structure of DNA using the X-rays made by Rosalind Franklin

2 strands wound around each other like a twisted ladder Strands are held together by hydrogen bonds between the nitrogen bases Adenine bonds to Thymine and Cytosine bonds to Guanine

Structure of DNA Nucleotide Hydrogen bonds Sugar-phosphate backbone Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section:

Mealor’s First Love

IV. Replication: Before a cell divides, DNA on every chromosome is copied so that each new cell has an identical set of chromosomes

DNA Replication IV. Replication: Before a cell divides, DNA on every chromosome is copied so that each new cell has an identical set of chromosomes TAAGTGTACACGTA ATTCACATGTGCAT TAAGTGTACACGTA TCACATCG TAAGTGTACACGTA TCACATCG TCACATCG AGTCCGATCGTAACTGGGTCACATCGTAAGTGTACACGTA TCAGGCTAGCATTGACCCAGTGTAGCATTCACATGTGCAT |||||||||||||||||||||||||||||||||||||||| AGTCCGATCGTAACTGGG TCACATCG TAAGTGTACACGTA |||||||||||||||||| |||||||||||||||||||||| TCAGGCTAGCATTGACCC AGTGTAGC ATTCACATGTGCAT AGTGTAGC AGTGTAGC ATTCACATGTGCAT TAAGTGTACACGTA ATTCACATGTGCAT

Make a complimentary strand ATT CGT ACG TTT ACT

Make a complimentary strand ATT CGT ACG TTT ACT

Make a complimentary strand ATT CGT ACG TTT ACT TAA

Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA

Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC

Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC AAA

Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC AAA TGA

I. How DNA works to create our traits – DNA cannot leave the nucleus I. How DNA works to create our traits – DNA cannot leave the nucleus. A copy of the DNA code is made in the nucleus into RNA. RNA travels to the ribosome where the code is read and the protein is assembled

The nitrogen bases in every gene make a code Every three bases makes one codon One codon is the code for one amino acid Long chains of amino acids make proteins ****Proteins determine an organisms traits and characteristics

Making a Protein – Translation Section 12-3 Nucleus Messenger RNA Messenger RNA is transcribed in the nucleus. mRNA Lysine Phenylalanine tRNA Transfer RNA The mRNA then enters the cytoplasm and attaches to a ribosome. Translation begins at AUG, the start codon. Each transfer RNA has an anticodon whose bases are complementary to a codon on the mRNA strand. The ribosome positions the start codon to attract its anticodon, which is part of the tRNA that binds methionine. The ribosome also binds the next codon and its anticodon. Methionine Ribosome mRNA Start codon Go to Section:

Making a Protein Section 12-3 Go to Section: The Polypeptide “Assembly Line” The ribosome joins the two amino acids—methionine and phenylalanine—and breaks the bond between methionine and its tRNA. The tRNA floats away, allowing the ribosome to bind to another tRNA. The ribosome moves along the mRNA, binding new tRNA molecules and amino acids. Growing polypeptide chain Ribosome tRNA Lysine tRNA mRNA Completing the Polypeptide The process continues until the ribosome reaches one of the three stop codons. The result is a growing polypeptide chain. mRNA Translation direction Ribosome Go to Section:

The Genetic Code Making a Protein: Translation DNA in the Nucleus: ATA GCT CCG TTA Code is made into RNA: UAU CGA GGC AAU ***In RNA Thymine is replaced by Uracil Amino Acid Chain is made at the ribosome: Tyrosine: Arginine: Glycine: ___________ Go to Section:

The Genetic Code Making a Protein: DNA in the Nucleus: ATA GCT CCG TTA Code is made into RNA: UAU CGA GGC AAU ***In RNA Thymine is replaced by Uracil Amino Acid Chain is made at the ribosome: Tyrosine: Arginine: Glycine: Asparagine http://www.learnerstv.com/animation/biology/Proteinsynthesis.swf Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA GCG CCC AAT RNA: AAU CGC GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine: Glycine: Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU CGC GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine: Glycine: Leucine This protein will determine a characteristic or trait Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acid Chain (Protein): Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Leucine: Go to Section:

The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Leucine: Valine This protein will now determine a trait or a characteristic Go to Section:

Structure of DNA Nucleotide Hydrogen bonds Sugar-phosphate backbone Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section:

III. Mutations- changes in the DNA sequence that affect genetic information (not all are harmful) Can affect all types of cells A. Germ Mutations- affect sex cells – inherited by offspring (ex- Down Syndrome) B. Somatic Mutations – affect other cells- not inherited (many cancers caused by somatic mutations)

IV. 2 types of mutations A. Gene Mutations (#1) - changes in a single gene. 2 types of gene mutations- 1. Point mutations- affect only one nucleotide *Can be caused by substitutions 2. Frameshift mutations - type of point mutation where nucleotide is inserted or deleted;affects every amino acid after that point. *Can be caused by deletion or insertion

Effect of Mutations Sickle cell disease single nucleotide change AT

Gene Mutations: Substitution, Insertion, and Deletion Go to Section:

B. Chromosomal Mutations (#2) - changes in whole chromosomes B. Chromosomal Mutations (#2) - changes in whole chromosomes. 4 types of chromosomal mutations. 1. Deletion- loss of all or part of chromosome 2. Duplication- segment of a chromosome is repeated 3. Inversion- chromosome becomes reversed 4. Translocation- part of a chromosome breaks off and attaches to a different chromosome

Chromosomal Mutations Section 12-4  Chromosomal Mutations Deletion Duplication Inversion Translocation Go to Section:

V. What are the effects of mutations? A. Proteins are altered. B. Proteins are unable to perform “normal” functions. Sometimes mutations are harmful, sometimes there is no affect, and sometimes mutations can be helpful. (Helpful when mutation produces a trait that aids in survival)

Organisms Can Change!

VI. Genetic Manipulation- when humans change the genes of an organism to achieve a desired result. A. Selective breeding- allowing only the individuals with desired traits to reproduce. 2 types Hybridization-crossbreeding dissimilar individuals: offspring will have the best of both Ex: donkey x horse = mule Inbreeding-breeding individuals with similar characteristics: maintain certain characteristics in offspring Ex: German Shepard x German Shepard = German Shepard

VII. Genetic Engineering – Desired genes are removed from one organism and added or recombined into another organism. This forms a transgenic organism with recombinant DNA A. This is used to make proteins not normally made by the cell. Can be used to produce: Drugs like insulin, Vaccines, Plants resistant to Insects, Reduce pollution, Better crops/meat

VIII. Evolution –natural process through which species change over time A. The environment “selects” the best traits – only those best suited will survive and pass on their traits to offspring. B. Evolution– occurs because of genetic differences caused by mutations in DNA

Concept Map Section 15-3 Evidence of Evolution includes The fossil record Geographic distribution of living species Homologous body structures Similarities in early development which is composed of which indicates which implies which implies Physical remains of organisms Common ancestral species Similar genes