Tina Khoury Jeremy Gerbig Derek Blanchard Kerwin Dunham

 Achieve ◦ E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts).  Find optimum temp where color change will be found.  ~ 30-37°C  Find optimum concentration of Cl. ◦ Gene originally from coral.  Backup Plan ◦ Use high temp parts to make E. coli fluoresce at high temp instead at low using a different gene. ◦ Expressing high (green) and low (red) temp. genes in one sequence.

 Isolate plasmid  Digest with appropriate enzymes.  Confirm base pair length  Ligation of confirmed digested Biobrick parts  Ligate final Biobrick arrangement  Confirm arrangement and biobrick standards  Grow under different environmental conditions

 Isolate biobricks out of well Plates.  BBa_I12007 – Promoter  Created oligo - RBS  BBa_E Gene  BBa_B Double Terminator

 Part 1 ◦ BBa_I12007  82Bp  Promoter: modified lambda Prm Promoter  (OR-3 obliterated)  2010 Kit Plate 2 Box 5 Well 11L, pSB2K3  gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatt tataaatagtggtgatagatttaacgt

 Part 3 Gene ◦ Spring 2008 Distribution Source Plate D pSB1A2Source Plate 1002 ◦ 3 BBa_E1010  681Bp  Gene: highly engineered mutant of red fluorescent protein from Discosoma striata (coral)  2010 Kit Plate 1 Well 18F, pSB2K3  atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtca cgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagtta ccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgt taaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatg aacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaag ttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagctt ccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagac ggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttac aaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgct gaaggtcgtcactccaccggtgcttaataa How It Was Suppose To Be Done?

 Part 4 & 5 Super Part BBa_B0015 ◦ BBa_B0010 doubleT  129 Bp  Stop, T1 from E. coli rrn B  (Transcriptional Terminator)  2010 Kit Plate 1 Well 13D, pSB1A2 ◦ BBa_B0012  Stop, TE from coliophage T7  (Transcriptional Terminator)  Source Plate 1000 Well 1B, pSB1A2  ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtt ttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcacctt cgggtgggcctttctgcgtttata How It Was Suppose To Be Done?

 Part 2  RBS to small

 Transform the bacteria.  Grow the transformed bacteria.  Isolate & check plasmids. ◦ Gel Electrophoresis

 The complete complex Biobricks sequence! ◦ Combine 3 parts  BBa_I12007 – Promoter  Created Oligo- RBS  BBa_E Gene  BBa_B Double Terminator

 Combining biobrick parts by digestion & ligation. BBa_I PromoterBBa_I RBS + Gene BBa_B Double Terminator SX & P

 Combining biobrick parts by digestion & ligation. BBa_I12007 –Promoter +Created oligo- RBS BBa_B Double Terminator S E & SX & P BBa_E1010 Gene

H2O5ul 10x FastBuffer 1.5 ul Enzyme 1.75ul Enzyme 2.75ul MasterMix

 10x ligation Buffer 2ul  T4DNA ligase 2ul  Gene 1ul  Double Terminator 5ul  H2O 5ul  Incubate room temp. 1hour  Store at 4℃

BioBrick PartPromoter BBa_I12007Double terminator BBa_B0015Ribosome BBa_B0032 ResistanceKANA/K we used KANAMP Test tube A1ul Promoter part BBa_I120071ul DT part BBa_B00151ul Ribosome part BBa_B0032 B5ul Promoter part BBa_I120075ul DT part BBa_B00155ul Ribosome part BBa_B0032 C1ul pblue script D1ul H2O Test tubesPromoterRBSDouble Terminator A75 colonies52 colonies43 colonies B212 colonies292 colonies216 colonies C1200 colonies D0 colonies Growth After Plating

Latter 13,12,11,10,9,8,7,6,5, 4, 3,2 1,latter Our digestion was successful a band of 681 was our target for the Gene 100bp 250bp 500bp 750bp 1000bp 100bp 250bp 500bp 750bp 1000bp Gene BBa_E1010 Isolation

Expected  Promoter –82bp  Double terminator- 129bp  RBS was not ran due to size of only 13bp Double Terminator--Promoter Ladder 1,2, 3,4 5,6,7 100bp 250bp 500bp 750bp 1000bp Double Terminator Promoter (BBa_B0015) (BBa_I12007)

 Expected Gene 681 Bp  1 st cut Spe1 Xbal  Redigested ◦ Spe1 EcoR1 100bp 250bp 500bp 750bp 1000bp 1,2,3 Gene

 Ligation problem possibly low functioning EcoR1  Promoter & RBS – not sure if ligated correctly due to RBS small size 13bp. Difference can’t be seen on gel  Gene & DT – Believe only DT is showing up 129bp 1000bp 750bp 500bp 250bp 100bp 15,14,13,12,11,10,9,8,7,6 5,4,3,2,1 ladder (Promoter & RBS) (Gene & DT)

 We Concluded that EcoR1 was not fully functional.  So our parts were not cut open properly to ligate the Gene to the double terminator. 1000bp 750bp 500bp 250bp 100bp 9,8,7,6,5,4,3, 2 1 ladder Attempted Gene & Double Terminator Ligation

 No proper digestions around 810bp.  No Ligation?  Error Analysis:  Still low functioning enzymes & Resuspension fluid had been left out of 4C for undisclosed amount of time. 100bp 250bp 500bp 750bp 1000bp 15,14,13,12,11,10,9,8,7,6,5,4,3,2,1 ladder Attempted Gene & Double Terminator Ligation

We were successful in isolating and confirming 3 of our Biobrick parts. Gene Promoter Double terminator. Given more time, fresh enzymes and other properly working materials ligating of our biobrick parts would have been successful.

 Openwetware.org  Partsregistry.org   /z jpeg  part=A1549  8/Week8b/week8b/node3.html  mages/themes/from_genes_to_genomes/images/bacterial_tr ansformation/ eng- AU/bacterial_transformation_large.jpg