Warm Up: (11_5) ATGCGTCGT What is the complementary DNA strand? Based on this complementary strand what would the mRNA strand be?

Make your mRNAs! You are just making nucleotides!!! Do not link nucleotides together!

DNA to Protein Translation Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes

DNA to Protein Translation Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes – tRNA contains an anticodon: three nucleotides on the tRNA that are complementary (match up with) the mRNA

DNA to Protein Translation Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes – The start codon (methionine) is the first to go through

DNA to Protein Translation Elongation: A polypeptide chain is formed. – tRNA’s with the proper anticodon match up with the mRNA. – They move through the ribosome,

DNA to Protein Translation Termination – Process stops when a stop codon is reached

DNA to Protein Translation Termination – Process stops when a stop codon is reached Disassembly Polypeptide (protein) is released as the three types of RNA separate

Protein Synthesis Videos VHPQM MrOM MrOM

Reading a codon chart!

Use the Codon Chart to make the amino acid sequence mRNA: AUG-CCA-GAU-GGA-UAA DNA: TAC-CCG-GAT-GGG-ATC

Translation Practice Problems 1.What is a codon? What is an anticodon? 2.How many amino acids are there? 3.What three types of RNA are involved in translation, what function does each play? 4.What is a polypeptide chain? What does it eventually turn into? 5.Explain how tRNA assists in building a protein 6.Explain how protein production is stopped. 7.Transcribe the following DNA Template strand to mRNA 3’ TACAATAGGGTCTCAGCACGCCCCATT 5’. Then decode the anti-codon sequence (hint: you need to use your mRNA sequence for this). Last, translate the mRNA sequence to an amino acid sequence

Process:Where is this process located (assuming eukaryote cell)? Is DNA directly involved in process? Which types of RNA are involved? End Result and Purpose Transcription Translation

Lets Practice Translation Take your mRNA strand and translate it! – Use the transfer RNA anticodons as a check – If you cannot find the amino acid you are looking for you may have made a mistake…. Show Ms. Spencer the process when you have completed it!

Codon Bingo (Can Repeat!!!!) 1.alanine 2.glutamate 3.leucine 4.serine 5.arginine 6.glutamine 7.lysine 8.tryptophan 9.asparagines 10.glycine 11.methionine 12.tyrosine 13.aspartate 14.histidine 15.phenylalanine 16.threonine 17.cysteine 18.isoleucine 19.proline 20.valine 21.stop

DNA Replication Think – Pair – Share When do cells need to replicate their DNA?

DNA Replication Think – Pair – Share When do cells need to replicate their DNA? Cell Division! Prokaryotes: Binary Fission Eukaryotes: Mitosis and Meiosis

DNA Replication 1.Helicases separate DNA strands, this creates a replication fork

DNA Replication 1.Helicases separate DNA strands 2.DNA polymerase adds complementary nucleotides to the strand

DNA Replication 1.Helicases separate DNA strands 2.DNA polymerase adds complementary nucleotides to the strand 3.DNA polymerase finishes replicating and falls off, two separate DNA molecules result

DNA Replication 1.Helicases separate DNA strands 2.DNA polymerase adds complementary nucleotides to the strand 3.DNA polymerase finishes replicating and falls off, two separate DNA molecules result 4.Each new DNA has one original DNA strand and one new DNA strand, this is called semi- conservative replication

DNA is made in the 5’ to 3’ direction That means that the leading stand can copy uniformly, the lagging strand is copied in segments, these segments are called Okazaki fragments

DNA Replication 1.Helicases separate DNA strands, this creates a replication fork

DNA Replication Videos Okazaki Fragments: