Using a Single Nucleotide Polymorphism to Predict Bitter-Tasting Ability Can you Taste PTC ?

Important concepts drug efficacy Science evolves from past discoveries. Modern biological research merges genetics, biochemistry, comparative studies and bioinformatics. Receptors: Genetic differences in taste and smell drug efficacy

Taste in Mammals Mammals can distinguish only five basic tastes Sweet Sour Bitter Salty Umami (the taste of monosodium gluatmate)

Taste in Mammals Taste perception is a two-step process 1st…A taste molecule binds to a specific receptor on the surface of a taste cell Question..WHAT IS A RECEPTOR????? Question..WHAT DETERMINES THE STUCTURE OF A RECEPTOR 2nd …The taste cell generates a nervous impulse, which is interpreted by the brain

An Example: Taste in Mammals Stimulation of “sweet cells” generates a perception of sweetness in the brain Taste sensation is ultimately determined by the wiring of a taste cell to the cortex in the brain If you have a sweet cell But it expresses a “bitter taste receptor” Bitter molecule will be perceived as being sweet!

Taste in Mammals Taste recognition is mediated by specialized taste cells that communicate with several brain regions through direct connections to sensory neurons

While there are only 5 tastes there are thousand more olefactory (smell) receptors (OR) Smell is like taste—a receptor – a protein that binds to a molecule that we smell. Similar also to how many drugs work (the drug binds to a cell protein—or receptor) All are coded by specific genes

A Serendipitous Observation The genetic basis of taste first observed by accident in 1930’s PTC = phenylthiocarbamide Prepared by Arthur Fox at Du Pont Company in late 1920s Lab partner C.R. Noller complained of bitter taste but Fox had no taste

Albert Blakeslee with Jimson Weed Carnegie Department of Genetics, Cold Spring Harbor, New York, 1933 Followed up by Albert Blakeslee at Carnegie Department of Genetics showed that inability to taste is recessive Published in 1932

Albert Blakeslee, AAAS Convention, 1938

Taste test: Phenylthiocarbamide (PTC) Arthur Fox, "The Relationship Between Chemical Constitution and Taste” (Arthur Fox and C.R. Noller) Albert Blakeslee, "Genetics of Sensory Thresholds: Taste for Phenyl Thio Carbamide"

Punnett Square

Molecular Genetics of PTC Tasting Gene identified in 2003 by Dennis Drayna TAS2R38 gene Polymorphism associated with PTC tasting SNP--Nucleotide position 145 Taster = C Nontaster = G Change in Amino acid 49 …. (proline)  (alanine)

Analysis of the Trait--CAPS Cleavage amplified polymorphisms Amplify a region of TAS2R38 gene by PCR Primers used in the experiment: CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG AGGTTGGCTTGGTTTGCAATCATC Then cut with restriction enzyme (HaeIII) RFLP-Restriction Fragment Length Polymorphism

Analysis by eletrophoresis

2% Agarose Gel Electrophoresis

What is the relationship between this trait and our ancestors? What is the normal state? To taste or to not taste?

Multiple Sequence Alignment

Advantage: Taste or not to taste?

More Complication: More than 1 PTC Haplotypes Postition Taster Nontaster 145 C (proline) G (alanine) 785 C (alanine) T (valine) 886 G (valine) A (isoleucine)

How does HaeIII Cut the taster allele? Hae III restriction site = GGCC In the regions around the 145 SNP Taster 141 GCAGGCAGCCACT Nontaster 141 GCAGGCAGGCACT

Compare primer to sequence: CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG primer anneal TTTTTGGGATGTAGTGAAGAGGCGG Taster TAGTGAAGAGGCAGCCACTG Nontaster TAGTGAAGAGGCAGGCACTG

Compare primer to sequence: CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG primer anneal TTTTTGGGATGTAGTGAAGAGGCGG 3’ AAAAACCCTACATCACTTCTCCGTC Taster 5’ TAGTGAAGAGGCAGCCACTG Nontaster TAGTGAAGAGGCAGGCACTG

Compare primer to sequence: CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG primer anneal TTTTTGGGATGTAGTGAAGAGGCGGCCACTG……….. 3’AAAAACCCTA CATCACTTCTCCGTC Taster TAGTGAAGAGGCAGCCACTG Nontaster TAGTGAAGAGGCAGGCACTG

http://bioinformatics.dnalc.org/ptc/animation/ptc.html

After PCR HaeIII cut site Taster TAGTGAAGAGGCGGCCACTG Nontaster TAGTGAAGAGGCGGGCACTG

Results of the 2012 PTC Taste Receptor 1. According to the class data (YOUR DATA???), how well does TAS2R38 genotype predict PTC-tasting phenotype? Phenotype Genotype Strong taste Weak Taste Nontaste TT 4 ----24% 12 – 28% Tt 6—35% 12- 28% tt---- 7--- 41% 19- 44%

What does this tell you about classical dominant /recessive inheritance? Dominate– If you have one copy of a gene you will express that trait Ability to taste is dominant Recessive—Trait that is masked by the dominate form of the trait..Need two copies of this gene if it will be expressed

How does the Hae III enzyme discriminate between the C-G polymorphism in the TAS2R38 gene. HaeIII cuts at the sequence GGCC This is at the 143-145 position of the gene The nontaster has a GGGC and won’t cut

The fwd primer has the HaeIII recognition site GGCC The fwd primer has the HaeIII recognition site GGCC. How is this different from the seq. of the gene? The gene sequence has an A—the primer a G.

What characteristic of the PCR reaction allows the Primer sequence to “override” the natural gene sequence. In PCR—the product produced always has primer….it starts with a primer and ends with a primer….so the sequence in the primer (and not the gene) is what appears in the final product This creates a Hae III restriction site in the taster allele, but not the non-taster.

Consider the terms below for mutations: Synonymous Substitution of one base for another in an exon of a gene coding for a protein, so that the amino acid sequence produced is the same. Synonymous substitutions and mutations affecting noncoding DNA are collectively known as silent mutations Nonsynonymous Substitutions that result in amino acid replacements are said to be nonsynonymous What sort of mutation is the G-C polymorphism in the TAS2R38 gene? Taste………..CCA = proline Nontaste……GCA = alanine

Other mutations in the TAS2R38 gene Positition Taster Nontaster 145 C (proline) G (alanine) 785 C (alanine) T (valine) 886 G (valine) A (isoleucine) These three mutations influence the ability to have this bitter taste perception. They are inherited together as a unit.

Many people are nontasters…more than what is expected if bitter taste was the ONLY trait under natural selection SO…. Is there some factor that makes this a positive outcome to balance out the negative effect of not tasting bitter? Is there an advantage to being a heterozygote (like sickle cell anemia)? Maybe….Maybe the NONTASTING form allow for individuals to taste another type of bitter molecule and so these people may know to avoid potentially toxic compounds.

Methods in DNA typing How are these techniques different from that used in forensic crime lab. Here we use a SNP and RFLP Crime labs use VNTRs and STRs and sequencing Samples are checked carefully to insure they are not mixed up

ETHICAL ISSUES? Consent? Knowledge of use? After use—samples stored or destroyed?

Genotype Taste Strong Phenotype Weak Non

Olfactory Receptors (ORs) Largest mammalian gene family ~1,000 genes or 4% of total genes Can detect ~10,000 different odors Each OR gene expressed in 1 in 1,000 epithelial cells Multiple receptors bind different parts of an odorant molecule Odor code: different odorant molecules are detected by different combinations of receptors

OR Evolution Mice: 20% of ORs are inactive Primates: 30-40% of ORs are inactive Humans: 60% of ORs are inactive Human-chimp comparisons: OR genes are diverging quickly OR genes are under natural selection

The future: Pharmacogenetics