Keith A. Seifert 1, Ursula Eberhardt 2, Conrad L. Schoch 3 1 Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Ontario 2 CBS Fungal Diversity Centre, Utrecht, the Netherlands 3 National Centre for Biotechnology Information, Bethesda, MD (GenBank) Promoting fungi in the DNA barcoding movement

MSA symposium 2010 Politics! 1:00 Advances in DNA barcoding for fungi. Conrad L. Schoch, Keith A. Seifert Specific Genes 1:30 DNA barcoding using cytochrome c oxidase I (COI): A valuable addition to oomycete molecular taxonomy. Gregg Robideau et al. 2:00 Barcoding the Yeasts – Which Genes? Cletus P. Kurtzman 2:30 Coffee Break Applications 3:00 Barcoding the Dothideomycetes and Sordariomycetes. Andy N. Miller 3:30 Barcoding agaric fungi in the Great Smoky Mountains National Park: What have we learned? Karen W. Hughes et al. 4:00 Challenges and successes in ITS barcoding of fungal communities in Alaskan boreal forest soil. L. Taylor 4:30 Discussion Aftermath A chat over beer

IMC Symposium U5 – Fungal Barcoding Chairs: Ursula Eberhardt & Keith Seifert Promoting fungi in the DNA barcoding movement KA Seifert*, U Eberhardt, CL Schoch Practice towards DNA barcoding of the nectriaceous fungi P. Zhao, J. Luo, W.-Y. Zhuang* DNA Barcoding of the mycobiota in indoor environments R A Samson* The ITS region as barcoding for medical fungi W Meyer*, C Serena, S Chen, M Arabatzis, A Velegraki DNA barcoding of arbuscular mycorrhizal fungi ( Glomeromycota ) A. Schuessler*, H. Stockinger, M. Krueger DNA barcoding of fungal endophytes from a Eucalyptus grandis tree in South Africa K Pillay, M Gryzenhout*, B Slippers, MJ Wingfield QBOL - Barcoding organisms of quarantine importance to Europe J.Z. Groenewald*, W. Quaedvlieg, P.J.M. Bonants, N. Boonham, P.W. Crous

Overview – The politics of DNA barcoding. – What happened to cox1 ? – Should ITS be the official Fungal Barcode? – Data standards for the barcode keyword. – Data resources for DNA barcoding. – International barcoding projects Our goal: Motivate mycological participation in DNA barcoding! – Formalize the fungal barcode. – Establish Fungal Working Group – Develop new fungal barcoding projects. – Participate in multi-kingdom projects. “DNA, you know, is Midas’ gold. Everybody who touches it goes mad.” Maurice Wilkins, quoted in The Eighth Day of Creation

What is DNA barcoding? Pre-2002 (or whenever) 1.Pileus comex to comparmulate, lemellae ascending-adnote, peleipellis of clonate cells, chilocystidia ventruiore to eubryludinal, basidiospores with pronviant apical gum pore.……………………………………………………………………………………….Panaeolus mallochii 2.Pileus glalions to finely primrose, lemellae dark blocked umpher, peleipellis hymenform, cheilocystidia a continuous timule margin, bandospins conspeniously compressed ………………………………………………………………………………….. Panaeolus summerbellii Post-2002 (or whenever) 1.CATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAT CGAATAAACTGGGTGGGTTGTTGCTGTCCCTCTCGGGGGAACTGTGCACGCCTTACCTTTTT TGTTTTTCCACCTGTGAA ………………………………………………………Panaeolus mallochii 2.CATTATTGAATAAACTTGGTTAGGTTGCTGCTGGCTCCTTGGAGCATGTGCACACCTAGCACC NTTTTTACCACCTGTGCACCCTTTGTAGACCTGGATACCTCTCGAGGAAACTCGGTTTGAGGA C ………………………………………………………………………………. Panaeolus summerbellii OR 1.…………………………………..……………………………………………………Panaeolus mallochii 2.….………………………………………………………………………………. Panaeolus summerbellii Trichocladium asperum Humicola grisea

Consortium for the Barcode of Life (CBOL) Regulates the ‘barcode’ keyword for GenBank Organization –Secretariat Smithsonian Institution, Washington, D.C., USA 5 people –Executive Committee 7 members, including Pedro Crous –Implementation Board 19 members, including Conrad Schoch –Members 200 Member Organizations, 50 countries Natural history museums, biodiversity organizations Users: e.g., government agencies Private sector biotech companies, database providers Facilitates barcoding but does not fund research

The Barcode Keyword in GenBank The Barcode Data Standard Sequence records with… –Voucher specimens –On-line metadata –Reliable standard of taxonomic identification –Agreed gene region sanctioned by peer review by CBOL Implementation Board –Sequence traces Identification of unknowns of ALL kingdoms (except bacteria) –GenBank –Barcode of Life Database (BOLD)

What is DNA Barcoding? Part 2. (or two or three genes?) All Kingdoms, All Species, One gene (or two or three genes?) The purpose is identification … NOT phylogeny In animals, the barcode gene is cytochrome oxidase 1 ( cox1 or CO1) A single copy mitochondrial gene, AT rich 648 bp region is the core for animals In plants, the barcode genes are matK and rbcL – Hollingsworth et al., 2009, PNAS 106: 12794–12797, In fungi, the barcode gene has not been formalized – By default it is cox1 until an alternative is accepted Barcode

Big science – More than $100,000,000 Biodiversity Institute of Ontario (Guelph) Netherlands Centre for Biodiversity Naturalis (Leiden) – € 30 million High throughput sequencing – Near genome centre volumes – Immediate data release policy (based on public genome model) is controversial – Primer mixes often used for PCR – M13 tagged sequencing primers – Data release papers What is DNA Barcoding? Part 3.

Taxon specific ‘campaigns’ Development of multikingdom databases –For use by all scientists and the public… not just mycologists Multi-kingdom projects –QBOL – Quarantine Barcode of Life Ecological projects –IM-Bol Indoor Mycota Barcode of Life Geographic Projects –Moorea What is DNA Barcoding? Part 4. mooreabiocode.org

Barcode of Life Database – BOLD Mirrored in China, negotiations with ECBol, Australia, Mexico Accepts ITS sequences as barcodes Submission open to anyone Few fungal sequences Spreadsheets for metadata No specific fungal format Process can be tedious Images of specimens Descriptions ‘Automated’ GenBank submission

Barcode Submission Tool Familiar submission process Trace archive available ITS sequences not yet accepted as barcodes Submission open to anyone Few fungal barcode sequences are now cox1 Metadata must be stored off-site

RefSeq Targeted Loci Bacteria: all type sequences Fungi: 200 sequences from AFToL, 28S, 18S, just beginning INSD (International Nucleotide Sequence Databases) DDBJ EMBL GenBank submission selection & some curation (NCBI) RefSeq model organisms reference organisms genomic level 16S rRNA* other molecular markers other RNAs GenBankRefSeq Not curatedCurated Author submitsNCBI creates from existing data Only author can reviseNCBI revises as new data emerge Multiple records for same loci commonSingle records for each molecule of major organisms Records can contradict each other Data exchanged among INSDC membersExclusive NCBI database Akin to primary literatureAkin to review articles

RefSeq Accession # Additional references RefSeq references Expanded qualifiers Project number

Criticisms of DNA Barcoding Not science (or bad science) A threat to classical taxonomy Removes funding from classical taxonomy Standardization of markers impossible Standardization of markers impossible Oversimplifies delimiting species Oversimplifies delimiting species It is not phylogeny Distrust and questioning of CBOL’s mandate National pride National pride Disciplinary pride Disciplinary pride

iBOL Member Nations Each central node should have a high-throughput DNA barcoding facility Now Canada US France Poland Scientific Steering Committee (mycologists): Pedro Crous, Keith Seifert

ECBOL- European Consortium for the Barcode of Life Mission: To unleash the potential of European expertise and collections to contribute towards identifying life on earth. Plan: Establish a Network of European Leading Laboratories (NELL) Formalise National DNA barcoding campaigns in each European country Establish new projects and barcoding campaigns, Functioning as the European node for international initiatives such as iBOL Participating countries: Belgium, Finland, France, Germany, Italy, Lithuania, Netherlands, Norway, Poland, Portugal, Spain, Switzerland, U.K. ECBOL2 meeting June 2010, Braga, Portugal Lorenzo Lombard

Selecting barcode genes International Nucleotide Sequence Database Collaboration – INSDC, GenBank, the European Molecular Biology Laboratory and the DNA Data Bank of Japan – CBOL Implementation Board decides by peer review which gene regions receive BARCODE status Possible reasons for rejection of cox1 – PCR problems (amplification or primer problems) – Patterns of inter- and infraspecific variation – Resolving power Selection of new genes – Patterns of inter- and infraspecific variation – Prefer a ‘barcode’ gap – Universality of primer pair etc.

Comparison of barcodes in Oomycetes (250 species) ITScox1LSU Percent of strains within species between species Average pairwise distance n=375 n= 1179 Min 0 Mean Max Min 0 Mean Max Min 0 Mean Max Min 0 Mean Max Min 0 Mean Max Min 0 Mean Max Courtesy Gregg Robideau & André Lévesque

cox1 Barcoding of Eumycota & Oomycota 0 introns 1 intron 2 introns 3 introns 7 introns Species resolution in Penicillium cox167.1 % B-tub81.2 % ITS24.5 % F. oxysporum genome 1 F. circinatum DAOM F. sacchari DAOM F. verticillioides genome ** F. circinatum DAOM b1 F. graminearum DAOM F. graminearum DAOM F. circinatum DAOM b5 F. oxysporum genome 2 3 spp./3 major clades. Identical barcodes. Fusarium. Low resolution. Multiple copies.

All Fungi Barcode of Life Planning Workshop Rossman, AY Report of the Planning Workshop for All Fungi DNA Barcoding. Inoculum 58(6): 1-5. Smithsonian Conservation and Research Center Front Royal, Virginia May 2007 Zasmidium nocoxi Crous

The ITS reality… Hurray! Large reference database –most not barcode data standard compliant Robust primers Strong demand from many mycologists that this be the fungal barcode –Especially ecologists studying environmental metagenomics

The ITS Reality – BOO! Multiple copies within species –At this conference… –Dan Lindner – Laetiporus, this conference –Uwe Simon & M. Weiss – Ascomycetes –Of concern for cloning based and metagenomic studies wanting to use barcode ID databases Serious lack of resolution in Ascomycetes –Possibly too short – bp optimum barcode but subtract 150 bp 5.8S… Chimera problems for some methodological approaches

Fungi Dikarya per net TEF RPB2 RPB1 TEF RPB2 RPB1 The Ascomycete Barcode Problem ITS (and cox1 ) lack resolution in many groups A second barcode is needed – TEF1-α – RPB1 or RPB2 – Mcm7 Schmitt et al Persoonia 23: – FG1565 – MS204 – FG1093 V. CBS/ C. AAFC Ascomycete Barcode Working Subgroup? Courtesy J. Spatafora

Action Establish Fungal DNA Barcoding Working Group Chair: Conrad Schoch International Membership members Establish Ascomycete subgroup (or other subgroups?) Establish Working Plan Prepare Fungal Barcoding proposal For peer reviewed publication For CBOL implementation board approval CBOL will support meetings of WG as necessary

Possible approaches Volunteers needed for Fungal Working Group Collaborators to provide data Mine data from existing publications Collaborators to provide DNA Multiple strains per species Multiple species per genus Authorship open to all who contribute AFTOL model Sequencing of other markers part of main proposal or as separate activity CBOL agreement with Life Tech CONTACT: Conrad Schoch:

Fungal DNA Barcoding – Proposed Proposal General Barcode for Fungi – rDNA internal transcribed spacer (ITS) Secondary barcodes – Yeasts rDNA large subunit (28S, LSU) D2 region – Ascomycetes Second barcode required, subsequent proposal Oomycetes – A separate proposal – Data on ITS, cox1 and LSU now being prepared for publication – 2 barcode system rDNA internal transcribed space (ITS) rDNA large subunit (28S, LSU) D2 region Other groups?

CBOL Implementation Board Peer review of barcode marker proposals Chairs Robert Hanner, University of Guelph, Databases Peter Hollingsworth, Royal Botanic Gardens Edinburgh, Plant WG Line Le Gall, Muséum National d’Histoire Naturelle, Paris; Protist WG Neil Sarkar, Marine Biol. Lab., Woods Hole, MA; Data analysis WG Conrad Schoch, NCBI, GenBank Taxonomy, Fungal WG Lee Weigt, Smithsonian Inst., Washington, DC; Leading Lab Network CBOL Campaign and Project Leaders George Amato, American Museum of Natural History, Conservation Damon Little, NY Botanical Garden, TreeBOL Marc De Meyer, Royal Mus. Central Africa, Belgium; Tephritid Barcoding Initiative Yvonne Linton, NHM, London; Mosquito Barcoding Initiative Dirk Steinke, University of Guelph, MarBOL Mark Stoeckle, Rockefeller University, ABBI Pablo Luis Tubaro, Museum of Natural Sciences, Argentina, ABBI Liaisons for Associated Initiatives Paul De Barro, CSIRO Agriculture Australia, invasive species Scott Federhen, NCBI, GenBank Taxonomy Paul Hebert, University of Guelph, iBOL Daniel Masiga, ICIPE, Nairobi, Kenya, East Africa Chris Meyer, Smithsonian Institution, Washington, Moorea/BioCode Sujeevan Ratnasingham, Biodiversity Institute of Ontario, BOLD

Taxonomic group# spp.Volunteers for data Pezizomycotina Saccharomycotina 1000 Taphrinomycotina 150 Agaricomycotina Ustilaginomycotina 1700 Pucciniomycotina 8300 Glomeromycotina 170 Mucoromycotina 325 Kickxellomycotina 265 Zoopagomycotina 190 Entomophthoromycotina 275 Blastocladiomycotina 180 Chytridiomycotina 700 Neocallimastigomycotina 20 Microsporidia1300 Rozella22

Keith Seifert: Ursula Eberhardt: Conrad Schoch: Websites Thanks for images: Pedro Crous André Lévesque & Gregg Robideau Joey Spatafora