Coming soon to a genetics lab near you! NBCEC Beef Genetic Workshop Clay Center, NE March 27, 2004 Marker adjusted EPDs
! !Thyroglobulin- marbling (Gene Star) ! !Calpastatin- tenderness (Gene Star) ! !Calpain- tenderness(MARC) ! !Leptin- fat deposition ! !DGAT- milk fat and protein Cattle genes affecting carcass traits
! !Single gene selection is worse than single trait selection ! ! Need to incorporate with EPDs ! !We need to rapidly identify sufficient number of genes that explain the majority of the genetic variation ! ! Need for additional laboratory tools Current limitations in genomic research
! !Large expensive projects - require international collaborations ! !Cattle physical (BAC) map ! !10 labs from US, Canada, UK, France, Brazil, New Zealand, Australia ! ! Complete in Summer 2004 Additional laboratory tools
Mapping a trait to a gene
! !Sequence the cow genome ! ! Funding from NHGRI; USDA; Texas; Genome Canada; New Zealand; Australia; National, Texas and South Dakota Beef Council; UK; and Norway - $54+ million (6X coverage, 10K full length genes, SNPs) ! ! Started Feb complete 2006? Ultimate physical map
! !BAC map and genome sequence will help fine map QTL ! !Need more QTL populations to identify more genes and for more traits ! ! SNP map will be used to develop low cost, high throughput genome scans ! ! Use industry populations? How do we identify more genes faster?
! !Develop haplotyped markers Implementation of Marker Adjusted EPDs AGGCTC TGGCTC TGCCTC TGCTTC TGGCAC TACTTC TGCTTGTGCTTGTGCTTGTGCTTG
! !Develop haplotyped markers Implementation of Marker Adjusted EPDs AGGCTC14% TGGCTC 25% TGCCTC 17% TGCTTC 1% TGGCAC 10% TACTTC 12% TGCTTG 21% Functional alleles 1)AGCTC, TGCAC, TGCTC 2)TGCTC, TGTTC, TGTTG, TATTC
! !Validate/replicate and estimate effect (different genetics and environment) ! !Evaluate interaction of different markers for the same trait ! !Evaluate effect upon additional traits ! !Selection pressure for each gene based upon effect of allele substitution, gene interaction, effects on different traits, and breeding objectives ! !Need some continual phenotyping to estimate effect Implementation of Marker Adjusted EPDs
! !Carcass traits- marbling, tenderness ! !Growth – bend growth curve ! !Milk production- composition ! !Feed efficiency – expensive to measure ! !Reproduction- dissect components ! ! Twinning population ! !Health traits - difficult to measure ! !Utilize genetic diversity- crossbreeding Genes affecting additional traits
! !Parentage ! !Verification system for animal identification ! ! Same markers used for parentage and animal ID ! ! Government subsidize genotyping ! ! Who maintains database and has access??? ! ! Added value with animal records Additional uses for DNA markers
! !BAC map, genome sequence, pedigree populations ! !Identify additional markers, QTLs (publicly available) ! ! Develop haplotype system ! !Provide GPE cycle 7 as a validating population ! ! Published or patent submitted ! ! Not for product development ! !Work with NBCEC to incorporate DNA markers with EPDs MARC’s role in advancing cattle genomics