1. Utilizing Genomics in genetic improvement Molecular genetics as a tool in wildlife breeding, management and conservation (An African Buffalo case study) Ben Greyling ARC-API, Irene

2. Menu  Role of Mol. Gen. in wildlife management/conservation/breeding  The ABC of DNA  The African buffalo: A case study  Genomics: Where do we stand?  The Cattle model: from genetic variation, to marker assisted selection to quantitative variation  Cape buffalo – recent developments

3. Primary objective of conservation and management To protect diversity, ensure sustainable use of the resource  Driving forces: need to qualify and quantify Role of Mol tools: Supply baseline info  Levels of genetic variation, inbreeding  Pop structure – genetic distances/assignment?  Gene flow between populations?  Effective population size vs. census size  Admixture (Genomics..)  Relationship between variation and fitness/adaptation  Gene regulation/expression under environmental control

4. More applications…  Forensics and traceability: Individual ID  Parentage verification (selection and management tool)  Hybrid identification  Genomics: Quantitative variation – from genotype to phenotype  Epigenetics: Environments effect on genes - heritable trait expression..

5. … AACGTGTTGACGCCGTAATGCATAAT CTHISWILLEVENTUALLYDRIVEYOUC RAZYCGCTAGCCTTCGGCAATC... The value of Mol Gen tools: Making sense of “useless information”

6. A A C G C T T A G C T A G C T C A T T G C G A A T C G A T C G A G T T insertion deletion Point mutation (SNP) 3000 000 000 letters per cell…

7. African buffalo: A major role player in our ecosystems/metapopulation  Largest populations confined to conservancies  Model species with regard to pop. dynamics - factors affecting it  Genetic variation, structure, gene flow, disease status, etc. Contributed immensely to conservation and management strategies

8. Case studies: Population structure  KNP vs. HiP 99% accurate assignment of individuals to pops due to genetic distance

9. Case studies: Genetic variation Periods of low N e for some populations in SA: ?? sustainability of genetic variation ?? compromised adaptation in response to changing environment? Example: Genetic erosion in HiP: 1% per year

10. East vs. southern African subpopulations?  Little genetic differentiation  East/southern African population a separate management unit, differ substantially from central/west African lineage  Substantial variation in both sub-populations

11. Gene expression/regulation: The Y-Chromosome Its raining men  Environment and body condition: switch on/switch off…  Sex ratio distorted: more males in the wet season  Particular genotypes dominate depending on environment (season) – affect sex ratio  Sex ratio and BTB-link?

12. Heterozygote-fitness-correlation (HFC)  Low genetic variation = low body condition – affect genes on the “Y”  Bad genes expressed in southern KNP, link to BTB, what the Y is going on?….  Females can also affect sex ratio…  Epigenetic factors?  BTB susceptibility may have an epigenetic link – heritable..

13. Ranches: management-scenario’s  Small populations, restricted gene flow  Controlled breeding (non-random mating)  Fragmented populations and “lines”  Breeding and selection among “lines”, e.g. Addo-Lowveld  Preference for market-desired phenotypes

14. Potential consequences of ranching  Reduction in genetic variation (inbreeding?)  Increase in frequency of deleterious alleles  Loss of adaptive genes/fitness  disease resistance, reproduction, growth etc.  Reduction in effective pop size – sustainability of variation?  Admixture – potential outbreeding depression  Compromised adaptability

15. Genomics to the rescue: Linking the DNA code to performance and phenotype (amongst others…)  SNP vs. full genome sequences – from a good amount of info to a desired amount of info  Powerful tools to address needs of wildlife industry  Substantially applied to livestock  Quantitative genetics: Selection tool for superior genetics  Fast track genetic improvement

16. Genomics for buffalo?  3K SNP panel already developed identified using next generation sequencing technology  Projects in pipeline using the 3K panel = more powerful approach  Buffalo and quantitative genetics: Breeding values on the horizon?  Scope for genomic breeding values…

17. Requirements for Genomics:  Accurate pedigrees  Phenotypic records  Reference populations  DNA (SNP) profiles  Test populations

18. The future is now with this technology Are we ready to adopt?