Using mutants to clone genes Objectives: What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype of interest?

Reading References: Westhoff et. al.  Molecular Plant Development: from gene to plant. Chapter 3: 52-65.

Positional (map-based) Cloning Map based cloning is a dependable method of cloning a gene using a mutant phenotype, molecular genetic markers and genetic recombination. This method is most easily done in organisms where the necessary tools (genetic map, physical map and or sequence of the genome) are available.

Positional (map-based) Cloning 1. Use the mutant phenotype and DNA-based genetic markers of known position to map, using recombination, the gene of interest to a site on a specific chromosome.

DNA-Based Genetic Markers The genomes of two individuals of the same species are rarely identical and can have many nucleotide differences between them. These variations in DNA sequences often do not alter the function of a gene but can be used as phenotypes in genetic mapping by detecting the differences using: 1. PCR amplification (simple sequence-length polymorphism = SSLP) 2. a combination of both PCR amplification followed by restriction endonuclease digestion (cleaved amplified polymorphic sequences = CAPS).

Small Insertions and deletions (SSLP) in DNA sequence can be identified using PCR and gel electrophoresis PCR primers amplify this region Chromosome of Individual #1 CTGGACGACGACGACTTACC GACCTGCTGCTGCTGAATGG Chromosome of Individual #2 CTGGACTTACC GACCTGAATGG These simple sequence length polymorphisms SSLP can be used as co-dominant markers for specific positions on a chromosome. Homozygote #1 Homozygote #2 Heterozygote

DNA single nucleotide polymorphism may be identified using CAPS Chromosome of Individual #1 CTGGGAATTCTTACC EcoR1 site Chromosome of Individual #2 CTGGGAAGTCTTACC Amplify by PCR #1 x #2 F1 Ind #1 Ind #2 Restrict amplified fragments with EcoR1 and separate on an electrophoretic gel.

Mapping to DNA-Based Genetic Markers The genomes of individuals form different populations of the same species differ in a large number of SSLPs/CAPS. This variation can be detected and used as genetic markers for specific positions on chromosomes. When two such individuals are crossed all the differences will segregate in the F2 progeny and can be mapped relative to one another or any novel phenotype in one of the parents. Eg. Arabidopsis populations from different parts of the world are called ecotypes: Columbia (ecotype from southern US)(Col) Landsberg erecta (ecotype from Germany)(Ler)

Small Insertions and deletions in DNA sequence can be identified using PCR and gel electrophoresis PCR primers amplify this region Chromosome of Columbia (Col) ecotype homozygous for SSLP allele at locus 8, chromosome 1 CTGGACGACGACGACTTACC GACCTGCTGCTGCTGAATGG Chromosome of Landsberg erecta (Ler) ecotype homozygous for SSLP allele at locus 8, chromosome 1 CTGGACTTACC GACCTGAATGG Col SSLP 8 Ler SSLP 8 Heterzygote These simple sequence length polymorphisms SSLP can be used as co-dominant markers for specific positions on a chromosome.

SSLP markers can be mapped using recombination just like genes In a cross Columbia and Landsberg erecta, the resulting F1 progeny will be heterozygous at all SSLP loci that were identified between the two: SSLP 16C/SSLP 16L; SSLP 71C/SSLP 71L; SSLP 8C/SSLP 8L Therefore in the F2 generation they can be mapped relative to one another

SSLP markers can be mapped using recombination just like genes Chromosome 1 of Columbia ecotype showing SSLP markers SSLP8C SSLP83C SSLP16C SSLP14C SSLP41C Chromosome 1 of Landsberg erecta ecotype showing SSLP markers SSLP8L SSLP83L SSLP16L SSLP14L SSLP41L

Arabidopsis genetic map showing the position of SSLP markers. 1 2 3 4 5 SSLP 8 SSLP 4 SSLP 102 SSLP 83 SSLP 25 SSLP 24 SSLP 43 SSLP 39 SSLP 71 SSLP 14 SSLP 68 SSLP 95

Apetala2 mutant has flowers where the sepals and petals are replaced by reproductive organs

Apetala2 mutant has flowers where the sepals and petals are replaced by reproductive organs AP2 normal flowers > ap2 flowers AP2 protein is required to make sure that the proper organs are made in the outer part of the flower. We are studying how floral morphogenesis is controlled during development and would like to determine what kind of protein is encoded by AP2. ie Which of the 30,000 Arabidopsis genes known by DNA sequence (entire genome has been sequenced) is AP2.

Procedure For Mapping a Mutant Phenotype Relative to Defined DNA Markers X Chromosome ? ap2/ap2 (Col) AP2/AP2 (Ler) chromosome 1 SSLP 16C/SSLP 16C SSLP 16L/SSLP 16L chromosome 4 SSLP 71C/SSLP 71C SSLP 71L/SSLP 71L F1 AP2/ap2 SSLP 16C/SSLP 16L SSLP 71C/SSLP 71L F2 See how often the Columbia allele of the AP2 gene (ap2) segregates with the Columbia alleles of SSLP 16; SSLP 71 and all other mapped SSLP loci.

ap2/ap2 (Col) x AP2/AP2 (Ler) Procedure For Mapping a Mutant Phenotype Relative to Defined DNA Markers ap2/ap2 (Col) x AP2/AP2 (Ler) F1 AP2/ap2 Ap2 Mutants isolated from the F2, DNA extracted from each and tested for different molecular markers. Plant 1 Plant 2 Plant 3 Plant 4 Plant5 Plant 6 Plant 7 Plant 8 F2 ap2/ap2 ap2/ap2 ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2 What is the expected frequencies of the alleles for one molecular marker in these F2 progeny assuming no linkage to AP2? Col SSLP8C SSLP83C SSLP16C SSLP14C SSLP41C Ler SSLP8L SSLP83L SSLP16L SSLP14L SSLP1L

SSLP genotypes in DNA sequence of the ap2 mutants can be identified using PCR and gel electrophoresis PCR primers amplify this region Chromosome 1 of Columbia (Col) ecotype homozygous for SSLP allele at locus 8, CTGGACTACTACGAGTTACC GACCTGATGATGCTCAATGG Chromosome1 of Landsberg erecta (Ler) ecotype homozygous for SSLP allele at locus 8, CTGTTACC GACAATGG SSLP 8C SSLP 8L Heterozygote These simple sequence length polymorphisms (SSLP) can be used as co-dominant markers for specific positions on a chromosome.

Procedure For Mapping a Mutant Phenotype Relative to Defined DNA Markers ap2/ap2 (Col) x AP2/AP2 (Ler) F1 AP2/ap2 Ap2 Mutants isolated from the F2 and DNA extracted F2 ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2, ap2/ap2 Chromosome # SSLP 71 #4 C/L C/C L/L C/L C/L L/L C/L C/C SSLP 8 #1 C/C C/C C/C C/C C/L C/C C/C C/C SSLP 83 #1 C/C C/C L/C C/C C/C C/C C/C C/C SSLP 16 #1 C/C C/L L/C L/L C/L L/L C/C L/C Col SSLP8C SSLP83C SSLP16C SSLP14C SSLP41C Ler SSLP8L SSLP83L SSLP16L SSLP14L SSLP41L Which SSLP loci are linked to ap2?

Positional cloning: Pick the best answer**iClicker!! Using data from the previous slide, which of the molecular markers is linked to AP2: SSLP71 and SSLP8 SSLP8 and SSLP83 SSLP83 and SSLP16 SSLP8 SSLP71 and SSLP16 Drew in M0 fish hit gametes with mutagen, Drew gametes, M1 mates with wildtype produces M2 hets…..those M2 fish mate to produce some m/m mutants

Chromosome of Columbia ecotype with ap2-1 mutation [ ] ap2-1 SSLP8C SSLP83C SSLP16C SSLP14C SSLP41C Chromosome of Landsberg erecta AP2 SSLP8L SSLP83L SSLP16L SSLP14L SSLP41L The ap2-1 mutant phenotype is found to segregate with SSLP83C and SSLP8C but no others. The map distance from each of these two to AP2 is 1/16 = 6.25 map units. If there is 12.5 map units between SSLP8 SSLP83 the AP2 gene must lie between these two SSLP sites. 1 mu = 270,000 bp = 60 genes (30,000 genes in 500 mu) 6.25 mu = 1,687,000 bp with roughly 750 genes.

Positional Cloning Genes in the AP2 locus SSLP8C SSLP83C AP2 AP2 Genetic map recombination DNA from the AP2 locus With 10 genes gene = Genes in the AP2 locus https://gbrowse.arabidopsis.org/cgi-bin/gb2/gbrowse/arabidopsis/?name=AT4G36920 Show 100 kbp

The Sequences For All Annotated Genes Are Available Sequence: AT1G30960.1 Date last modified  2003-05-27Name  AT1G30960.1 Tair Accession  Sequence:2015773GenBank Accession  NM_102835Sequence Length (bp)  1314  Sequence      1 ATGAAAGCTT TTAGATCTCT ACGTATACTA ATTTCCATCT CACGAACGAC   51 GACGAAGACA ACACCTCGTA ATCCCCATCA AGCACAAAAC TTTCTCCGCC  101 GATTTTACTC AGCGCAGCCG AATCTAGACG AACCCACTTC CATCAATGAA  151 GACGGATCAA GCAGCGACTC TGTTTTCGAT AGTAGTCAAT ACCCAATCGA  201 CGATTCCAAT GTAGATTCCG TGAAGAAGCC CAAGGAAGCA ACTTGGGATA  251 AAGGGTACAG AGAAAGAGTA AACAAAGCCT TCTTTGGAAA CTTGACAGAG  301 AAAGGTAAAG TGAAAGTTGC AGAAGAAGAG AGTTCTGAAG ATGATGAGGA  351 TAGTGTTGAT AGGTCAAGGA TTCTCGCTAA GGCTCTCTTA GAGGCTGCGT  401 TAGAGTCACC AGATGAAGAA CTTGGTGAAG GTGAAGTTAG AGAAGAAGAT  451 CAGAAGTCGC TTAATGTCGG CATCATCGGT CCACCTAATG CAGGAAAATC  501 TTCGCTGACT AATTTCATGG TTGGAACAAA GGTTGCTGCT GCTTCACGGA  551 AGACTAACAC GACGACACAT GAAGTGTTAG GAGTATTGAC AAAAGGAGAT  601 ACACAAGTCT GTTTCTTCGA TACTCCGGGT CTGATGCTGA AGAAAAGCGG  651 ATATGGTTAC AAAGACATCA AGGCTCGTGT GCAAAATGCT TGGACTTCTG  701 TTGACCTGTT TGATGTCCTC ATTGTTATGT TTGATGTCCA TAGGCATCTC  751 ATGAGTCCCG ATTCAAGAGT GGTACGCTTG ATCAAATACA TGGGAGAAGA  801 AGAAAATCCG AAACAAAAGC GCGTTTTATG TATGAACAAA GTTGATCTGG  851 TTGAGAAGAA AAAGGATCTA TTAAAGGTTG CTGAGGAGTT CCAAGATCTT  901 CCGGCATATG AAAGATACTT CATGATATCG GGACTTAAGG GATCAGGAGT  951 GAAAGATCTT TCCCAATACT TAATGGATCA GGCTGTTAAA AAACCATGGG 1001 AAGAAGATGC ATTCACGATG AGTGAAGAAG TCTTGAAGAA CATTTCTCTT 1051 GAAGTTGTTA GGGAGAGATT ACTAGACCAT GTCCATCAGG AAATACCATA 1101 TGGTCTGGAG CACCGTCTAG TGGACTGGAA AGAGCTGCGT GACGGGTCTC 1151 TTAGAATTGA ACAGCATCTC ATCACTCCTA AACTTAGCCA ACGCAAGATT 1201 CTTGTAGGCA AGGGCGGTTG CAAGATCGGG AGGATAGGAA TTGAGGCCAA 1251 TGAAGAACTC AGGAGAATAA TGAACCGCAA AGTTCATCTC ATTCTCCAGG 1301 TTAAGCTCAA GTGA Comments (shows only the most recent comments by default)         Attribution type   name   datesubmitted_by    AGI-TIGR    2001-03-06submitted_by    GenBank    2002-08-20 General comments or questions: curator@arabidopsis.org Seed or DNA stock questions (donations, availability, orders, etc): abrc@arabidopsis.org

Positional (map-based) Cloning 1. Use the mutant phenotype and DNA-based genetic markers to map, using recombination, the gene of interest to a region on a specific chromosome. 2. Examine the sequence of chromosomal DNA from that region to determine the number of annotated genes. 3. Narrow down to correct gene using predicted function, mutant allele sequence, complementation, expression analysis etc.

Insertional Tagging Isolate mutant phenotype of interest from an insertional mutagenized population of plants. (Insertion DNA must be cloned: eg TDNA or Transposon). Check that the transposon or TDNA in the mutant co-segregates with the mutant phenotype. ---The segregation of an insert can often be followed using the phenotype of a gene encoded in the insert (eg Kanamycin resistance-remember this is a dominant marker), a probe for the insert or PCR primers that can amplify part of the insert. ---repetitive elements (eg. transposons) may complicate such an analysis.

Insertional Tagging Isolate mutant phenotype of interest from an insertional mutagenized population of plants. (Insertion DNA must be cloned: eg TDNA or Transposon). Check that the transposon or TDNA in the mutant segregates with the mutant phenotype. 3. Clone or amplify the chromosomal DNA at the site of insertion using the known sequence of the TDNA or transposon.

Insertional Tagging P coding region Gene X P coding region Gene X with insert of known sequence Portion of a chromosome with genes including the one with insert

Insertional Tagging Digest genomic DNA with restriction endonuclease Identify the fragment carrying the insert: Eg. 1. Make a library by ligating the fragments into a microbial vector and screen the colonies/plaques by hybridization using the insertion sequences as a probe 2. Ligate the fragments so that they form circles and identify the ones with insertions by: Plasmid rescue (if the insert includes bacterial origin of replication and a gene encoding resistance to a chemical, eg antibiotic resistance) Inverse PCR

Insertional Tagging P coding region Gene X P coding region Gene X with insert Portion of a chromosome with genes including the one with insert

Inverse PCR ligate Amplify by PCR Amplify by PCR andSequence

Insertional Tagging Isolate mutant phenotype of interest from an insertional mutagenized population of plants. (Insertion DNA must be cloned: eg TDNA or Transposon). Check that the transposon or TDNA in the mutant segregates with the mutant phenotype. 3. Clone or amplify the chromosomal DNA at the site of insertion using the known sequence of the TDNA or transposon. 4. Sequence the DNA flanking the TDNA or transposon from the mutant and use the sequence to identify the wild type gene.

Insertional Tagging Sequence Use sequences from gene X to identify the wild type allele. P coding region Gene X

Connecting a cloned gene with a mutant phenotype Despite the method of identifying the DNA, one must confirm that the gene DNA sequence (X) is the same gene that is mutated to give the phenotype of interest (gene M). Which approaches for verifying that SBEI was really the ‘R’ gene were used in the Bhattacharyya et al, 1990 paper we did in tutorial?

Connecting a cloned gene with a mutant phenotype Despite the method of identifying the DNA, one must confirm that the gene DNA sequence (X) is the same gene that is mutated to give the phenotype of interest (gene M). 1. Trans gene complementation 2. Sequencing gene derived from each mutant 3. Co-segregation analysis between gene sequence and the mutant phenotype 4.Reverse genetics

Connecting a cloned gene with a mutant phenotype Despite the method of identifying the DNA, one must confirm that the gene DNA sequence (X) is the same gene that is mutated to give the phenotype of interest (gene M). Trans gene complementation Transform a wild type copy of gene X into the mutant and determine if the transgene can rescue (complement) the mutant phenotype (if the mutant allele is recessive) OR transform the mutant allele of gene X into the wild type to see if the transgene will result in the mutant phenotype (if the mutant allele is dominant to wild type) Eg. If we believe that the AP2 gene (identified by floral phenotrype) encodes the MYB83 transcription factor we can transform the ap2 mutant (ap2 is recessive to AP2) with a DNA fragment carrying the wild type allele of MYB83 gene. The transformed plant should have a wild type phenotype if MYB83 is really the AP2 gene.

Connecting a cloned gene with a mutant phenotype 1. Transgene complementation. 2. Sequence gene X from several mutants homozygous for different alleles of gene M. If the ‘M’ gene and X gene are the same then one should find a gene X mutation in every M mutant. This hypothesis can be tested by sequencing gene X from the M mutant. If you have several mutants each of which is homozygous for a different allele then you should find that each mutant has a different mutation in gene X.

Connecting a cloned gene with a mutant phenotype Example: Genotype of plants homozygous for different alleles of the AP2 gene: AP2/AP2 ap2-1/ap2-1 ap2-2/ap2-2 -cloned a wild type gene, MYB83, encoding a transcription factor. Is MYB83 gene AP2? Clone MYB83 from each of the three plants above by PCR amplification. If MYB83 is AP2 then MYB83 from AP2/AP2 will have a wild type sequence. MYB83 from ap2-1/ap2-1 will have a mutation. MYB83 from ap2-2/ap2-2 will also have a mutation but different from that of ap2-1.

Connecting a cloned gene with a mutant phenotype 1. Transgene complementation. 2. Sequence gene X from several mutants homozygous for different alleles of gene M. 3. Cosegregation analysis. DNA-based markers (RFLP) identifying gene X should cosegregate with the mutant phenotype M in genetic crosses. This hypothesis can be tested by crossing mutant M to a wild type plant, self-fertilizing the F1 progeny to produce F2 progeny and scoring F2 plants for the mutant phenotype and the gene X molecular marker. Eg. Follow the segregation of a molecular marker for the MYB83 gene with the ap2 mutant phenotype.

Connecting a cloned gene with a mutant phenotype 1. Transgene complementation. 2. Sequence gene X from several mutants homozygous for different alleles of gene M. 3. Cosegregation analysis. 4. Reverse genetics. Identify mutant alleles of gene X using reverse genetics. Mutations in gene X should have the same phenotype as mutant M and fail to complement the M mutant phenotype. Eg. A loss of function mutation in the MYB83 gene should have an ap2 mutant phenotype.