2. Sequential Steps in Genome Mapping
Cytological and Genetic (Recombinational) Mapping
G- banding; mapping genes relative to bands; mapping genes relative to each other
Physical Mapping
Positioning cloned DNAs relative to cytological/genetic maps
using cloned genes/other markers from cyto/genetic map
Sequencing
Determining sequence of whole chromosomes
All chromosomes
using clones from physical map

3. Genome Projects
Determine Sequence of whole genomes from selected organism
Easiest done first – size and available genetic maps
Robotics/automation has increase rate of sequencing/mapping – now larger genomes are doable as long as interest is high
humans and close relatives
long-standing research organisms to add genomic data to existing info
pathogens, bio-terrorism agents

4. Need High Resolution Maps
More than cytological and genetic maps are necessary because physical distance (bps) is large compared to cytological/genetic distances
a G-band in humans ~ millions of bps
one cM = a million bps
need markers every thousand bps to get to a physical map
Gene markers aren’t dense enough
Use neutral DNA sequence markers – variations in DNA sequence that are not associated with any detectable phenotype (other than the DNA sequence itself)
Restriction Fragment Length Polymorphisms (RFLPs)
Minisattelite markers (VNTRs; used in DNA fingerprinting)
Microsattelite markers
Randomly Amplified DNA Polymorphisms (RAPDs)
Single nucleotide Polymorphisms (SNPs)
To be useful: must identify a locus that is polymorphic (at least two alleles, better if more than two) and that locus must be heterozygous to be useful in mapping (locus should exhibit high heterozygosity)

5. Mapping with RFLPs
RFLPs: variation in DNA sequence at a location that happens to be part of a restriction site in some individuals
EcoRI cuts the site CATGGAATTCGCT - one allele of this locus
EcoRI does not cut CATGCAATTCGCT – an alternate allele of this locus
EcoRI does not cut CATGGCATTCGCT – looks the same as #2 in RFLP analysis
RFLP Mapping in the figure above:
- two strains of haploid fungus, five different loci on one chromosome that are polymorphic for EcoRI sites
- two allele are designated by the strain name: O = Oak Ridge or M = Mauriceville
map the location of a trait m (mutant) to one of the RFLPs
Cross strains (meiocyte = diploid formed from two haploids) = heterozygous at all 5 RFLP sites and at m
Wild type (+) parent carries the M alleles; mutant parent (m) carries the O alleles
Progeny resulting from cross overs between 1 and 2, 2 and 3, 3 and 4, 4 and 5 are shown.
Note that m is always associated with 4O: consistent with linkage of m locus to RFLP 4
doesn’t mean that RFLP 4O is equal to the m mutation!
If you looked at enough progeny you may find recombinants between m and 4O and then get a map distance (RF) showing the linkage (see #1 in solved problem section and # 14 in challenging problems

6. Detecting RFLPs by Southern Blot Analysis
Look at map of locus containing RE site of interest
morph 1 = allele corresponding to middle RE site present
morph 2 – allele corresponding to middle RE site absent
Cut total genomic DNA from a homozygote for morph1, homozygote for morph 2, a morph1/morph2 heterozygot. Probe blot with DNA that overlaps the middle RE site
2 bands from morph 1; 1 band from morph 2; three bands (heterozygote)
Use this RFLP to determine if a trait is linked to this locus…

7. Using RFLP data in mapping
Parents:
Dd female is heterozygous for this RFLP
dd affected male is homozygous for morph 2
all affected children are homozygotes for morph 2
4 of 5 unaffected children are heterozygotes for the RFLP
1 unaffected child is homozygous for morph 2
Infer the phase of D and d in the female (heterozygous parent)
D is in cis with morph1
d is in cis with morph 2
the single Dd child (8) homozygous for morph 2 is likely a recombinant as shown
Other mapping problems using DNA markers follow a similar logic
Note that here it is CLEAR that the RFLP does not equal to the D allele – a recombinant between D and the RFLP is proof.

8. Simple Sequence Length Polymorphisms: Minisattelites/VNTRs
VNTR = variable number of tandem repeats
one, two, three,…etc in “head to head” orientation (same orientation)
sequences are 15 to 100 nucleotides long
detected in restriction digests of genomic DNA by southern blots
restriction fragments typically from 1 to 5 kb in length, with variation in length of fragment due to variation in the number of repeats
each specific repeat will be found at multiple loci in a genome, so you detect alleles at multiple loci in one experiment
Above shows VNTR/minisattelite repeat in an intron of a gene – four copies in this allele, other numbers in other alleles
Next slide shows VNTR alleles at multiple loci and the expected southern blot results

9. Multiple Polymorphic Loci Identified by One Specific Repeat
Cut genomic DNA and probe the blot with the repeat sequence
Note: more than two alleles possible for any given locus and multiple loci identified by a single repeat
All three individuals are heterozygotes at all three loci
Typical high heterozygosity for VNTRs

10. Simple Sequence Length Polymorphisms: Microsattelite Repeats
Tandem repeats of di or tri or tetra nucleotide sequences
Two alleles at a locus example below:
GTCTAGCACACACACACACACACACACAGTACGGAC
GTCTAGCACACACACACACACACACACACACACACCAGTACGGAC
As with VNTRs, multiple alleles possible (from zero to hundreds of copies)
Detection by PCR using primers that hybridize to unique (non-repetitive) sequences that flank the microsattelite locus

11. Mapping using Microsattelites
Results of PCR of a microsattelite locus of parents and progeny in a pedigree
Four alleles detected
Both parents are heterozygotes (high heterozygosity as with VNTRs) for different alleles
Affected individual carries dominant marker P and M’’ and M’ alleles at this locus
All affected progeny have M’’, none have M’; P appears to be linked to M’’
Chromosomes in parents:
M’’ P M’’’ p
M’ p M’’’’ p

12. Another Polymorphism: Detected as Randomly Amplified DNA Polymorphisms (RAPDs or Rapids)
Alleles are detected by the chance (random) hybridization of small PCR primers to different positions in a genome
When primers correspond to inverted repeats close together on a chromosome, they will produce small PCR products in a PCR reaction = this PCR product identifies one allele at that locus
Some individuals will have a variation in one of these sequences and so will not generate that PCR product = this is the alternate allele at that locus
Example: 10 nucleotide long primers sequences occur 1/1 million bps on average or about 3000 times per the human genome. A few of these will be present as inverted repeats close together on one chromosomes and will yield PCR products.

13. Mapping with RADP
RAPDs have to be heterozygous in one parent and absent from the other to be useful for mapping
Example = mother above has two RAPDs not present in father and not present in all progeny – so mother is heterozygous for this RAPD
Linkage of any trait to this RAPD can be checked in a cross or analysis of a pedigree
(do problem # 3 to practice using RAPD to map traits in a haploid)