GENETICS

Trait An observable characteristic of an organism Eye color Freckles Tongue rolling Hair color Dimples Widow’s peak Right or left handed Height

6. Phenotype The expression of a specific trait.

7. Allele A version of a gene. Different alleles have a different orders of DNA bases (letters). ATGTATGGCTATTAGGCTAT Two different alleles of the gene for eye color ATGTGCGGCTATTAGGCTAT

8. Dominant An allele that masks the recessive allele in a hybrid

9. Recessive An allele that is masked by the dominant allele in a hybrid

10. Genotype The specific alleles of a gene in an organism.

11. Heterozygous An organism with two different alleles of a gene

12. Homozygous An organism with two alleles that are the same

Are all traits inherited?

Are all traits inherited? NO! Some traits are inherited (in your DNA), others are acquired (from your environment). Genetics deals with inherited traits.