Transcription From DNA to RNA. Transcription From DNA to RNA.

Slides:



Advertisements
Similar presentations
How is RNA different from DNA? RNA (Ribonucleic Acid)
Advertisements

Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.
Molecular Genetics Protein Synthesis Gene Regulation Mutations Biotechnology.
Protein and Translation. Central Dogma of Biology _____________________________________: -Transcription: The decoding of DNA into mRNA -Translation: The.
RNA Ribonucleic Acid.
Protein Synthesis Chapter 11.
Ribonucleic Acid (RNA) & Protein Synthesis Ms. Napolitano & Mrs. Haas CP biology.
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.
RNA Ribonucleic Acid. Structure of RNA  Single stranded  Ribose Sugar  5 carbon sugar  Phosphate group  Adenine, Uracil, Cytosine, Guanine.
Chapter 12 DNA and RNA. Discovery of DNA How do genes work?  Several scientists from began investigating the chemical nature of genes.  DNA.
Objectives Identify that amino acids are coded by mRNA base sequences and are linked to become proteins Describe how mRNA codons are translated into amino.
Gene Expression From a gene to a protein. Central Dogma (Crick 1958) Determines the genetic flow of information.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
PROTEIN SYNTHESIS The Blueprint of Life: From DNA to Protein.
Sections 3-4. Structure of RNA Made of nuleotides Three differences between DNA & RNA Sugar DNA = deoxyribose sugar RNA = ribose sugar RNA is single stranded.
Section 12-3 RNA & Protein Synthesis
RNA & DNA Compare RNA & DNA Contrast RNA & DNA
RNA AND PROTEIN SYNTHESIS
Do Now Show a diagram of how you would split/ unwind the following Base pairs of DNA Draw the two new strands of DNA after replication.
Chapter 13: RNA and Protein Synthesis RNA. What is RNA? RNA (Ribonucleic Acid) – How is RNA physically different from DNA? 1. Single strand not a double.
DNA & Protein Synthesis. Vocabulary terms to learn: gene messenger RNA (mRNA) ribosomal RNA (rRNA) transfer RNA (tRNA) transcription RNA polymerase codon.
RNA and the business of making proteins. RNA structure RNA is the principle molecule that carries out the instructions coded in DNA RNA is a nucleic acid.
RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.
12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.
Compare and Contrast: DNA and RNA
RNA and Protein Synthesis
Ribosomes and Protein Synthesis
RNA and Protein Synthesis
CH 12.3 RNA & Protein Synthesis.
Heredity B-4.3 Explain how DNA functions as the code of life and the
Types of RNA TRANSCRIPTION translation
V. RNA Ribonucleic acid.
12-3 RNA & Protein Synthesis
How to Make a Protein?.
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS AND MUTATIONS
How do we get proteins from a bunch of A’s, T’s, C’s and G’s in DNA??
Proteins and Translation
Protein Synthesis.
How DNA and RNA make Proteins.
Chp: 12 Transcription & Translation
Amino Acid Activation And Translation.
PROTEIN SYNTHESIS.
RNA Ribonucleic Acid.
Protein Synthesis Section 12.3.
Translation (Protein Synthesis) RNA  protein.
Protein Synthesis: Transcription & Translation
Unit 7: Molecular Genetics
GENE EXPRESSION / PROTEIN SYNTHESIS
Ch Protein Synthesis Protein Synthesis Proteins are polypeptides
Protein Synthesis Section 3 Transcription and Translation
DNA replication, transcription, & translation
RIBONUCLEIC ACID (RNA)
Protein synthesis.
RNA & Protein synthesis
Transcription Using DNA to make RNA.
DNA Notes Section 12.3.
Protein Synthesis.
Protein Synthesis Chapter 10.
3 July 2019 P. 56 Complete Quick Lab p. 303 Compare and contrast:
TRANSLATION and MUTATIONS
The Production of Proteins by DNA
Presentation transcript:

Transcription From DNA to RNA

Transcription- Where does this happen? Where is the DNA?

Transcription- how RNA is made location= nucleus RNA polymerase runs along DNA strand in nucleus and makes RNA (mRNA) mRNA = messenger RNA (sends message outside of nucleus) mRNA leaves nucleus through a nuclear pore and meets up with a ribosome (rRNA) in the cytoplasm

Translation From RNA to Protein

Translation- Where does this happen? Where is the DNA? Protein synthesis – the manufacture of proteins Where are proteins made in the cell?

Translation- how proteins are made location= ribosome in cytoplasm Once mRNA is at a ribosome (rRNA), amino acids are assembled to make proteins Transfer RNA (tRNA) brings the appropriate amino acid to the growing protein chain

Genetic Code Genetic code – the language of mRNA instructions (blueprints) Read in three letters at a time Each letter represents one of the nitrogenous bases: A, U, C, G Codon found on mRNA; consists of three bases (one right after the other) 64 codons for 20 amino acids mRNA carries the codon (three base sequence that codes for an amino acid) tRNA carries the anticodon which pairs up with the codon tRNA brings the correct amino acid by reading the genetic code

Codon (cont’d) For example, consider the following RNA sequence: UCGCACGGU The sequence would be read three base pairs at a time: UCG – CAC – GGU The codons represent the amino acids: Serine – Histidine - Glycine

Codons (cont’d) AUG – start codon or Methionine UAA, UAG, UGA – stop codons; code for nothing; like the period at the end of a sentence

Protein formation Amino acids link together to form a protein The new protein could become cell part, an enzyme, a hormone etc.

Translation CODON ANTI CODON

SO: Say the mRNA strand reads: tRNA would bring the amino acids: mRNA (codon) AUG–GAC–CAG-UGA tRNA (anticodon) UAC-CUG-GUC-ACU tRNA would bring the amino acids: Methionine-Aspartic acid-Glutamine-stop

SUMMARY 1)mRNA is transcribed in the nucleus and leaves the nucleus to the cytoplasm 2) mRNA attaches to the ribosome 3) The codon on the mRNA is read by the anticodon on the tRNA 4) tRNA brings the amino acid as it reads mRNA 5) The amino acids are joined together to form a polypeptide (protein) 6) When a stop codon is reached (UAA, UAG, UGA) protein synthesis stops

What if things go wrong? MUTATION!!! If transcription or translation were to copy the wrong sequence, the incorrect amino acid could be added This would change the overall protein structure and could make the protein ineffective Example: Sickle cell anemia is caused by a single amino acid difference in the hemoglobin protein sequence

Gene Mutations Point Mutations – only occur at a single point in the DNA sequence – only changes a few amino acids Frameshift Mutations – shift the entire “reading frame” – change ALL the amino acids Substitution – one base replaces another Insertion – an extra base is inserted Deletion – loss of a single letter (makes entire base disappear!)

Deletion Substitution Insertion

Chromosomal Mutations Change in the number or structure of chromosomes Ex. – Deletion, Duplication, Inversion, and Translocation

Deletion Duplication Inversion Translocation