Gene Mutations.

Slides:



Advertisements
Similar presentations
DNA Mutations Biology 6(E).
Advertisements

DNA MUTATIONS.
TTGACATACCCGTAAT What would the complementary strand of this DNA molecule read? AACTGTATGGGCATTA.
Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,
Gene Mutations Chapter 11.
13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)
the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant
Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
MUTATIONS.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Wild Type HeadMutant Head (Antennapedia). I. Proteins and Mutations: A. Some proteins carry out functions within the cells of an organism. B. Other proteins.
Ch. 9.7 Mutations Every once in a while, cells make mistakes in copying their own DNA An incorrect base can be inserted or sometimes a base is skipped.
MUTATIONS Intro video
CHAPTER 14 SECTION 1 Mutations. Are mutations good or bad?  Some mutations lead to genetic disorders  Some mutations may cause a beneficial trait 
4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.
Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.
MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
Mutations.
The Cell Cycle.
Mutations.
“How does it affect the protein?”
Gene Mutations.
Mutations.
DNA MUTATIONS.
Gene Mutations.
Mutations.
Mermaid Syndrome Video.
Types of Mutations.
Mutations
Gene Mutations Chapter 11.
Mutations.
Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?
MUTATIONS.
Chapter 12.4 Mutations.
Mutations.
Mutations.
Human Genetic Mutations
To be successful today…
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations changes in the DNA sequence that can be inherited
A mutation is a change in an organism’s DNA.
Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Some mutations affect a single gene, while others affect an entire chromosome.
Mutations Section 12-4.
DNA Mutations.
Mutations.
Mutations.
A mutation is a change in an organism’s DNA.
Mutations Ms MacCormack Fall 2018.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations Section 12-4 Pages
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
Mutation, Natural Selection, and Artificial Selection
Mutation Notes.
Copyright Pearson Prentice Hall
Protein Synthesis and Mutation
Mutations: Changes in Genes
Presentation transcript:

Gene Mutations

Any mistake or change in DNA sequence Mutations Any mistake or change in DNA sequence What causes them? Random or Environment influences – X-rays, UV rays, radioactive materials, chemicals, medications

More about mutations Can be beneficial, harmless, or harmful 2 types: Gene & Chromosomal

Chromosomal mutation: affects whole or part of a chromosome Gene mutation: Changes to the bases in the DNA of ONE gene

1. Gene Mutations Change in one or more nucleotides Affects the amino acids and protein produced 2 types

 Point Mutation Change in a single base pair in DNA Ex: The dog bit the CAT The dog bit the CAR

Sickle Cell Anemia

Some Point Mutations are Harmless What amino acid is represented by the DNA sequence GGA? What amino acid is represented by the DNA sequence GGC? This change in the 3rd base of the codon is a point mutation, yet the amino acid would remain the same. Therefore, the protein would NOT be affected.

Some Point Mutations are Harmless This type of point mutation is called a silent mutation. Silent Mutations are possible due to the redundancy in the genetic code.

 Frameshift Mutation Single base pair is added or deleted from DNA Causes a shift in the “reading frame” Ex: Cystic Fibrosis EX: cystic fibrosis

Nonsense Mutations A point mutation or a shift in the reading frame can sometimes cause a premature STOP codon This type of mutation is called a nonsense mutation If the nonsense mutation occurs early in the mRNA sequence, the protein is greatly shortened and most likely non functional

Some mutations are beneficial Gain-of-function mutations produce a functional protein that results in an entirely new trait These mutations are usually beneficial and result in an advantage in an organism’s environment EX: The mutation that resulted in eyesight

Practice – Name that Mutation 1 2 Deletion ~ Frameshift Silent ~ Point 4 3 Insertion, nonsense ~ Frameshift Point 6 5 Deletion ~ Frameshift Nonsense ~ Point