Supporting Information Figs S1-S5 eGFP 35S HYG(R) Kan (R) pVS1-REP pVS1 Sta ggatccggtaccgtcgacacgcgtctgcagagatct BamHI KpnI SalI MluI PstI BgllI ΔpCAMBIA1302 (10590 bp) Fig. S1. Modified pCAMBIA1302 vector.

W T R PtPG23 PtPG22 PtPG21 ψPtPG9 PtPG20 PtPG24 Cluster I PtPG63 PtPG67 PtPG66 PtPG65 PtPG64 PtPG58 PtPG59 PtPG60 PtPG61 PtPG62 Cluster II ψPtPG20 93 96 100 66 95 74 99 88 0.1 Fig. S2. Hypothetical evolutionary histories of the Populus PGs in clusters I and II. Numbers on branches indicate the bootstrap percentage values calculated from 1000 replicates. ψ presents PG gene fragment. White boxes indicate the gene loss events. The letters T, W and R in the schematic diagram indicate putative tandem duplication, whole-genome duplication and rearrangements, respectively.

K s Fig. S3. The relationship between the synonymous substitution rate (Ks) and the expression divergence among Populus PG genes.

Leaf Inflorescence Anther Pistil Seed Embryo Shoot (a) (b) LOC_Os01g44970 LOC_Os01g45060 LOC_Os05g50260 LOC_Os01g36830 LOC_Os06g28670 LOC_Os05g20020 LOC_Os01g19170 LOC_Os06g16810 LOC_Os05g14150 LOC_Os05g46520 LOC_Os05g46510 LOC_Os02g03750 LOC_Os07g10680 LOC_Os07g10740 LOC_Os07g10700 LOC_Os07g10730 LOC_Os03g59330 LOC_Os03g11760 LOC_Os06g35320 LOC_Os06g35370 LOC_Os06g35300 LOC_Os06g40890 LOC_Os01g33300 LOC_Os02g10300 LOC_Os08g23790 LOC_Os06g31270 LOC_Os06g40880 LOC_Os01g43490 LOC_Os01g66710 LOC_Os11g14400 LOC_Os11g14410 LOC_Os01g07790 LOC_Os11g43750 LOC_Os12g36810 LOC_Os03g61800 LOC_Os07g14160 LOC_Os05g50960 LOC_Os01g43160 LOC_Os02g15690 LOC_Os08g01600 LOC_Os03g03350 LOC_Os09g26800 LOC_Os02g54030 LOC_Os09g31270 100 53 72 60 79 99 73 97 54 90 74 56 Fig. S4. Phylogenetic relationship among rice PGs (a) and their expression patterns (b). The phylogenetic tree was constructed using a ML procedure with the JTT model. Numbers on branches indicate the bootstrap percentage values calculated from 1000 replicates, and only values higher than 50% are shown. Classes I, II and III PGs are shaded blue, yellow and brown, respectively. The blue box indicates positive detection of gene expression in the corresponding tissue.

Tree 1 Tree 2 Tree3 Tree 4 Tree 5 class II class I PtPG58 PtPG56 PtPG60 PtPG59 PtPG63 PtPG61 PtPG64 PtPG62 PtPG23 PtPG22 PtPG27 PtPG21 PtPG46 PtPG24 PtPG45 PtPG44 PtPG65 PtPG20 PtPG67 PtPG66 PtPG33 PtPG5 PtPG40 PtPG37 PtPG39 PtPG38 PtPG11 PtPG10 PtPG35 PtPG52 PtPG26 PtPG73 PtPG72 PtPG74 PtPG70 PtPG75 PtPG71 PtPG3 PtPG48 PtPG19 PtPG68 PtPG53 PtPG55 PtPG17 PtPG34 PtPG2 PtPG31 PtPG47 PtPG6 PtPG41 PtPG30 PtPG4 PtPG42 PtPG29 PtPG43 PtPG28 PtPG49 PtPG15 PtPG51 PtPG9 PtPG69 PtPG18 PtPG12 PtPG1 PtPG7 PtPG57 PtPG14 PtPG50 PtPG8 PtPG36 PtPG32 PtPG13 PtPG25 PtPG16 87 78 48 100 60 56 94 91 98 99 92 77 45 62 74 61 49 80 70 96 90 31 58 66 95 54 0.2 Tree 2 At2g15460 At2g15450 At2g15470 At2g26620 At4g13760 At2g40310 At1g43080 At1g43090 At1g43100 At1g17150 At2g33160 At1g78400 At1g02790 At4g18180 At3g14040 At3g07850 At5g48140 At3g07820 At3g07840 At3g07830 At1g65570 At2g43860 At3g59850 At2g43870 At2g43880 At2g43890 At1g05660 At1g05650 At1g80140 At3g57510 At2g41850 At3g07970 At1g80170 At1g23460 At1g70500 At1g60590 At1g10640 At5g14650 At3g26610 At1g56710 At1g48100 At4g01890 At1g02460 At5g39910 At3g15720 At5g17200 At4g35670 At5g27530 At5g44840 At5g44830 At3g42950 At1g19170 At3g48950 At2g23900 At4g23500 At3g61490 At3g16850 At3g06770 At3g62110 At4g33440 At5g41870 At4g23820 29 44 57 69 97 85 30 93 65 71 50 46 17 21 24 55 47 52 Tree3 Loc_Os06g35370 Loc_Os06g35320 Loc_Os06g35300 Loc_Os06g40890 Loc_Os01g33300 Loc_Os02g10300 Loc_Os08g23790 Loc_Os06g40880 Loc_Os06g31270 Loc_Os11g14400 Loc_Os11g14410 Loc_Os01g43490 Loc_Os01g66710 Loc_Os01g07790 Loc_Os03g11760 Loc_Os03g59330 Loc_Os07g10730 Loc_Os07g10700 Loc_Os07g10740 Loc_Os07g10680 Loc_Os05g46510 Loc_Os05g46520 Loc_Os05g14150 Loc_Os06g16810 Loc_Os02g03750 Loc_Os05g20020 Loc_Os01g19170 Loc_Os06g28670 Loc_Os01g36830 Loc_Os05g50260 Loc_Os01g44970 Loc_Os01g45060 Loc_Os02g54030 Loc_Os09g26800 Loc_Os03g03350 Loc_Os05g50960 Loc_Os01g43160 Loc_Os02g15690 Loc_Os08g01600 Loc_Os07g14160 Loc_Os03g61800 Loc_Os12g36810 Loc_Os11g43750 35 59 53 18 12 41 67 Tree 4 Tree 5 PpPG4 PpPG2 PpPG3 PpPG6 PpPG5 PpPG1 PpPG11 PpPG9 PpPG10 82 63 SmPG11 SmPG5 SmPG14 SmPG7 SmPG8 SmPG10 SmPG16 SmPG9 SmPG15 SmPG2 SmPG1 SmPG4 SmPG13 SmPG6 25 27 Fig. S5. Phylogenetic trees used for molecular evolution analyses. The trees were reconstructed using a ML procedure with the JTT model and 1000 bootstrap replicates. Numbers at each node in the phylogenetic trees are bootstrap percentage values.