1. Introduction to Phylogenetics

2. Phylogenetics
Phylogenetics is the study of evolutionary relationships among a group of organisms.
Phylogenetic analysis is the means of inferring or estimating these relationships.
The result of phylogenetic studies is a hypothesis about the evolutionary history of taxonomic groups: their phylogeny

3. Phylogenetic tree
The evolutionary history inferred from phylogenetic analysis is usually depicted as branching, treelike diagrams that represent an estimated pedigree of the inherited relationships among molecules (‘‘gene trees’’), organisms, or both.
Human
Mouse
Rat
Fugu
Tetraodon
Zebrafish
Frog
Species tree

4. Why phylogenetic trees?
Phylogenetic trees are extremely handy tools used by biologists to understand:
- the composition of genomes,
- relationships among genes in humans and other species,
- the functions of proteins that run our cells,
- historical relationships among diverse species,
- the processes that generate unique body shapes,
- the origins of remarkable abilities in living organisms,

5. Types of trees
Rooted trees reflect the most basal ancestor of the tree in question
Unrooted trees do not imply a known ancestral root.

6. Terminologies Internal branch Node (common ancestors, hypothetical)
Nucleotide substitution or amino acid substitution
Internal branch
Node (common ancestors, hypothetical)
Leaf/operational taxonomic units (OTUs)
Root
External branch
outgroup

7. Terminologies
Nodes: represent taxonomic units. Internal nodes correspond to ancestral species that are not part of the data.
Internal branch: between 2 nodes. Internal nodes are connected by internal branches.
External branch: between a node and a leaf (OTUs). Leaves are connected to the rest of the tree by the external branches emanating from an internal node.
Leaf/operational taxonomic units (OTUs): The observed species (corresponding to the data) appear at the tip of the branches. Species/genes/population.
Horizantal branch length: The branch lenght usually represents the number of changes that have occured in that branch.

8. Outgroup: Is a taxon that is clearly more distantly related to the taxa of interest than any of them is to another of these taxa.
Tree topology: The branching pattern of a tree is called the topology.
Clade: A set of all taxa derived from particular common ancestor.
Cladogenesis: The process of branching.
Unscaled trees: Branch lengths are not proportional to the number of changes.
Scaled trees: Branch lengths are proportional to the number of changes

9. Altering the position of root, changes the meaning of Phylogenetic treeD B D C A B B A C D A B C D C D A B A B C D
C and D branch late
C and D branch early

10. Changing the taxon order doesn't matter

11. Types of trees Simply shows relative recency of common ancestor
A cladogram with branch lengths
A dendogram having all tips equidistant from root

12. Types of Phylogenetic Data
Biomolecular sequences: DNA, RNA, amino acid, in a multiple alignment
Molecular markers (e.g., SNPs, RFLPs, etc.)
Morphology
Gene order and content

13. Molecular Data Taxa Characters Species A ATGGCTATTCTTATAGTACG
There are two types of molecular data: characters and distances
Characters: can be a nucleotide / amino acid at a site in DNA /protein sequence, or the presence or absence of deletion or insertion at a site. That is each nucleotide/amino acid site in a DNA/protein sequence can be consider a character site.
Taxa Characters
Species A ATGGCTATTCTTATAGTACG
Species B ATCGCTAGTCTTATATTACA
Species C TTCACTAGACCT--TGGTCCA
Species D TTGACCAGACCT--TGGTCCG
Species E TTGACCAGTTCT-- TAGTTCG

14. Making trees using character-based methods
The main idea of character based methods is to search for a tree that requires the smallest number of evolutionary changes to explain the differences among the OTUs under study.
Such a tree is called maximum parsimonious (“simple”) tree.

15. As an example of tree-building using maximum parsimony, consider these four taxa:
AAG
AAA
GGA
AGA
How might they have evolved from a
common ancestor such as AAA?

16. Tree-building methods: Maximum parsimony

17. Molecular Data
Distance: the other type of data are distance data, which are computed from DNA or amino acid sequence data . These data are also called the distance matrix data, because the distance are usually presented in the matrix from.

18. Tree construction using distances

19. The simplest distance based method is UPGMA
UPGMA employs a sequential clustring algorithm, in which local topological relationships are inferred in order of decreasing similarity and a phylogenetic tree is built in a stepwise manner.
First we identify the two OTUs that are most similar to each other (having the shortest distance) and treat them as a new single OTU.
Such an OTU is is referred to as a composite OTU.
Subsequently from among the new group of OTUs, we identify the pair with the highest similarity and so on, until only two OTUs are left.

20. UPGMA

23. UPGMA
Consider a case of four OTUs. The pairwise evolutionary distances are given by the following matrix:
OTU 1 2 3 4
d12
d13
d14
d23
d24
d34

24. UPGMA: Construct a phylogenetic tree following UPGMA algorithm.

25. Distance Matrix A B C D E F 2 4 6 8

27. TRY THIS!!!

29. Neighbor joining Method
Neighbor-joining (Saitou and Nei, 1987) is a method that is related to the cluster method but does not require the data to be ultrametric. In other words it does not require that all lineages have diverged by equal amounts.
The method is especially suited for datasets comprising lineages with largely varying rates of evolution.

30. Neighbor joining Method
The neighbor-joining
method Is especially useful
for making a tree having a
large number of taxa.
Begin by placing all the taxa in a star-like structure.

31. Compute pairwise distances among all OTUs.
Retain the pair with smallest distance (neighbors). Group i and j in the tree. Connect these neighbors to other OTUs via an internal branch, XY.
When two nodes are linked, their common ancestral node is added to the tree and the terminal nodes with their respective branches are removed from the tree.

32. Neighbor joining Method

33. Applications of phylogeny
"Species" trees recover the genealogy of taxa, individuals of a population, etc.
Internal nodes represent speciation or other taxonomic events.
Species trees should contain sequences from only orthologous genes.

34. "Gene" trees represent the evolutionary history of the genes included in the study.
Gene trees can provide evidence for gene duplication events, as well as speciation events.
Sequences from different homologs can be included in a gene tree; the subsequent analyses should cluster orthologs, thus demonstrating the evolutionary history of the orthologs.

35. Tools/Softwares CLUSTALW PHYLIP PAUP Mega5
PHYLIP
PAUP
Mega5