BIOLOGY FALL 2014 MUTATIONS. WHAT ARE MUTATIONS? Mutations = changes in the genetic material Mutations can happen when cells make mistakes in copying.

Slides:



Advertisements
Similar presentations
Mutations Hollywood’s images of mutation. Mutations Hollywood’s images of mutation.
Advertisements

Mutations.
Mutations. Now and then cells make mistakes in copying their own DNA, inserting an incorrect base or even skipping a base as a new strand is put together.
Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.
DNA MUTATIONS.
MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.
Mutations
Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,
What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...
Mutations.
Genetic Disorders Genetic Mutations Because DNA controls characteristics of a cell it must be copied before a cell reproduces Sometimes mistakes occur.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
Slide 1 of 24 Copyright Pearson Prentice Hall 12-4 Mutations 12–4 Mutations.
MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
GENETIC MUTATIONS What is this picture depicting?.
4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Human Genetic Mutations
What are the functions of DNA?
Lecture 55 Mutations Ozgur Unal
Mutations.
Genetics Topic3.
DNA MUTATIONS.
Big Q: What are mutations? Big Q: How do mutations affect genes?
Mutations.
Mutations.
Inheritance Patterns and Human Genetics Chapter 12-1 & 12-2
Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,
Review: Can you tell the story of protein synthesis?
Copyright Pearson Prentice Hall
Warm Up 4 2/10 What are the 3 parts of a nucleotide?
Mutations (Ch 13.3).
Gene Mutations.
Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?
Chapter 12.4 Mutations.
Changes in DNA that affect genetic information
Mutations.
MUTATIONS 12-4.
The New Genetics Part I.
To be successful today…
Mutations.
Mutations.
Genetics Topic3.
Mutations: Causes and Effects
Mutations.
Mutations.
Human Genetic Disorders
Topic #3: Types of Mutations
Todays outline… Please pick up Notes/worksheet/your activity from yesterday Attendance Update: Blog – how to access Review yesterday’s Activity Todays.
Ch 12-4 Genetic Mutations.
Mutations Ms MacCormack Fall 2018.
12.4 Mutations Kinds of Mutations Significance of Mutations.
Copyright Pearson Prentice Hall
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Copyright Pearson Prentice Hall
Draw a conclusion from this graph for both the red and blue line
MUTATIONS 12-4.
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Don’t let this happen to you!!
Mutations.
Copyright Pearson Prentice Hall
Mutations Big Q: What are mutations?
DNA Mutations Types & their effects.
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Mutations: Changes in Genes
Presentation transcript:

BIOLOGY FALL 2014 MUTATIONS

WHAT ARE MUTATIONS? Mutations = changes in the genetic material Mutations can happen when cells make mistakes in copying their own DNA or can be caused by radiation or chemicals in the environment.

WHAT ARE MUTAGENS? Mutagens = agents in the environment that can change DNA Examples: UV Rays in Sunshine Industrial Chemicals X-rays

KINDS OF MUTATIONS Mutations that produce changes in whole chromosomes = chromosomal mutations Mutations that produce changes in a single gene = gene mutations

GENE MUTATIONS Three categories: 1.Substitutions 2.Deletions 3.Insertions

SUBSTITUTIONS Substitutions = changes one base to another A T T C G A G C T A T T C T A G C T How many amino acids are changed?

SUBSTITUTION EXAMPLE: SICKLE CELL ANEMIA Cause: (autosomal recessive) an A is changed to a T  glutamate to valine Results in the formation of abnormal hemoglobin that distorts certain blood cells Heterozyous – Malaria Resistance

DELETION Deletions = a piece of DNA code is lost A T T C G A G C T A T T C A G C T How many amino acids are changed?

DELETION EXAMPLE: CYSTIC FIBROSIS Different kinds of cystic fibrosis, but most commonly is caused by deletions Life expectancy ~ 37 years old

INSERTIONS Insertion : Extra piece of DNA is added A T T C G A G C T A T T C G C A G C T How many amino acids are changed?

INSERTION EXAMPLE: ALS ALS is a neurodegenerative disorder leading to dementia and muscle weakness Most common mutation that causes ALS is many insertions of “GGGGCC” which overproduces incorrect proteins that damage brain cells

GENE MUTATIONS Substitutions usually affect no more than a single amino acid, but deletions and insertions can have a more dramatic effect.

GENE MUTATIONS Deletions and insertions can cause frame shift mutations which means that multiple bases in the code are changed. thefatcatatetherat thefatcataatetherat

FRAME SHIFT MUTATIONS Frame shift mutations change every amino acid in the protein that follows the shift. Frame shifts can alter a protein so much that it is unable to function!

The location of the frame shift is important!! At the beginning: the fat cat ate the rat The fac ata tet her at At the end: the fat cat ate the rat the fat cat ate thr at Mutations at the BEGINNING of the gene damage MORE of the code!!