Genomics and the Growing World Steve Rounsley Dow Agrosciences.

Slides:



Advertisements
Similar presentations
Chapter 4: The Human World
Advertisements

Future directions in genetic epidemiology, impact on IT and Data requirements Nic Timpson MRC CAiTE Centre Department of Social Medicine.
1 Cyberinfrastructure Framework for 21st Century Science & Engineering (CIF21) NSF-wide Cyberinfrastructure Vision People, Sustainability, Innovation,
Wrapup. NHGRI strategic plan What does the NIH think genomics should be for the next 10 years? [Nature, Feb. 2011]
6 Mark Tester Australian Centre for Plant Functional Genomics University of Adelaide Research developments in genetically modified grains.
Food Security Prepared By :Rana Hassan Supervised By :Dr. Raed Alkowni
7 Billion - Where do you Stand?
Imagining the Future of Agriculture Robert Tse USDA Rural Development Yribarren Ranch Bishop, CA July 24, 2014.
Bioinformatics Student host Chris Johnston Speaker Dr Kate McCain.
Mohammad Abd Elgawad Emam Assistant Lecturer, Agronomy Department,Faculty Of Agriculture.
Technological Innovation for growth.. An Agricultural point of view
Off the Shelf: Innovation in family farming for sustainable agriculture Terri Raney, Editor The State of Food and Agriculture Food and Agriculture Organization.
The Global Food Security Challenge ( GLDN for ECA, Dec 18th.
1 Strategic Workforce Planning at Monsanto Stu Larson Global Strategic Workforce Planning Lead January 12, 2009.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
1 Water in Bioenergy Agroecosystems Workshop Industry perspective on water for bioenergy production Alistair Wyness, BP International Group Water Expert.
Brigitte Dias Ferreira AACCLA's 47th Annual Meeting and "Forecast on Latin America and the Caribbean" Conference September 29, 2014 Washington, DC Food.
PRT 2008 Lecture 1. Name of the Course Agriculture and Man.
Challenges Facing the Food & Agricultural Sector Robert L. Thompson Gardner Endowed Chair in Agricultural Policy University of Illinois at Urbana-Champaign.
Syngenta Biotechnology
Mali Work Packages. Crop Fields Gardens Livestock People Trees Farm 1 Farm 2 Farm 3 Fallow Pasture/forest Market Water sources Policy Landscape/Watershed.
Agricultural Innovation Kim Ritman Chief Scientist ABARES.
ABOUT THE GLOBAL FOOD CRISIS. Malnutrition around the world is nothing new…what is new is the inability of millions of already undernourished people to.
Bioinformatics and Biostatistics in Limagrain / Biogemma
Trends and driving forces in livestock production and trade in Sub Saharan Africa C. Sere and M. Herrero The Role of Livestock for ACP countries: challenges.
Biotechnology Technology is essential to science for such purposes as sample collection and treatment, measurement, data collection and storage, computation,
Priorities for the European R&D agenda with regard to sustainable intensification in dairy farming.
Topic: Population Density and Population Distribution Aim: How is population distributed throughout the world and how can that be measured? Do Now: 1.How.
Brought to you by: David Donnan, Partner A.T. Kearney November 2012 Can We Feed the World? Recipe for Change:
Rural Futures – Meeting Policy and Market Challenges: Secure Food Supply and Market Integrity Kevin Steel, Principal Adviser, Strategy Development 24 September.
Population Chapter 2 : Key Issue 1. Demography  Demography is the study of population geography  Key Issues of Demographics are:  Food Supply  Health.
Savvy Use of On Farm Resources to Boost Production and Sustainability Presentation to WFO Forum William Rolleston.
Big Data in Indian Agriculture D. Rama Rao Director, NAARM.
Unrestricted. © Siemens AG All rights reserved. Open Innovation 2.0 Dr. Walter Weigel VP External Cooperations Corporate Technology I Dublin, June.
State Standards Biotechnology. Understand how biotechnology is used to affect living organisms. Summarize aspects of biotechnology including: Specific.
The Future of Whole Human Genome Data Management and Analysis, Available on the Microsoft Azure Platform Today MICROSOFT AZURE APP BUILDER PROFILE: SPIRAL.
© 2016 Global Market Insights. All Rights Reserved Bio fertilizers market size to reach $1.66 billion by 2022.
Population Chapter 2 : Key Issue 1.
MarketsandMarkets™ Presents Soybean Derivatives Market worth $254.9 Billion by 2020
MarketsandMarkets™ Presents soybean derivatives is estimated to be worth $176, Million in 2015, and is projected to reach $254.9 Billion by 2020.
Agricultural Biotechnology in Turkey
Joslynn Lee – Data Science Educator
Kostas Seferis, i2S Data science and e-infrastructures can help aquaculture to improve performance and sustainability!
National press foundation visit
BBSRC – Agriculture and Food Security Framework
SMART and SAFE AGRICULUTRE - HARNESSING POWER OF DATA IN AGRICULTURE
The Human Population.
Kbv Research | +1 (646) | Vertical Farming Market Knowledge Based Value (KBV) Research Full report:
© 2016 Global Market Insights, Inc. USA. All Rights Reserved Global Vertical Farming Market to grow at 27% CAGR from 2017– 2024: Fractovia.org.
© 2016 Global Market Insights, Inc. USA. All Rights Reserved Precision Farming Market to grow at 14% CAGR from 2017 to 2024: Global.
© 2016 Global Market Insights, Inc. USA. All Rights Reserved Americas Container Technology Market to grow at 35% CAGR over
© 2016 Global Market Insights. All Rights Reserved Water-Soluble Fertilizers Market( ): Industry Analysis & Forecast Water-Soluble.
JESSE POLAND Kansas State University
Biotechnology Notes 8.L.2.1.
Agricultural Adjuvants Market
© 2016 Global Market Insights, Inc. USA. All Rights Reserved Fuel Cell Market size worth $25.5bn by 2024 Vertical Farming Market to.
Global Genetically Modified Seed Market : Trends, Forecast, and Opportunity Analysis 1.
Patrick S. Schnable Department of Agronomy
The Importance of “Genomes to Fields”
The Human Population and the Problems with Rapid Growth
Population Chapter 2 : Key Issue 1.
Research and Innovation in Agriculture
REVIEWING TITLE COMMITMENTS AND SURVEYS
HISTORY OF AGRICULTURAL DEVELOPMENT
Global megatrends (relevant for our business)
© 2016 Global Market Insights, Inc. USA. All Rights Reserved Fuel Cell Market size worth $25.5bn by 2024 Low Power Wide Area Network.
© 2016 Global Market Insights, Inc. USA. All Rights Reserved Fuel Cell Market size worth $25.5bn by 2024 Low Power Wide Area Network.
MarketsandMarkets Presents Agrigenomics Market by Application & Region - Global Forecast 2021.
MarketsandMarkets Presents Agricultural Biologicals Testing Market worth 1.12 Billion USD by 2021.
Next Generation Sequencing Market. Report Description and Highlights According to Renub Research market research report “Next Generation Sequencing (NGS)
Presentation transcript:

Genomics and the Growing World Steve Rounsley Dow Agrosciences

| 2 2

| 3 Global Mega Trends Demand Ag Innovation. Global Population Growth Rise of India & China Increasing Global Wealth Increasing Protein Demand Arable Land Diminishing Water Scarcity Climate Change Demand Factors Global Constraints Unprecedented Productivity Need Collision of Food & Feed & Fuel Increased Use of Biotech Crops Supply Response Factors

| 4 Headline goes here 4

5 Plant Genomes

| 6 In the beginning…..(circa 2000)

| 7 Genomic Research – Human compared to Plants

| 8 Plant Genomics Challenges Whole Genome Duplications Lee et al. (2012) Nucleic Acids Research doi:1093/nar/gks1104 PolyploidyHigh intra-specific diversityLarge genomes 30Gb 148Gb16Gb3.5Gb Transposon-rich genomes

9 Genomics at Dow Agrosciences

| 10 Sequencing Technology Driving Paradigm Shifts Printing costs for data from a single 27-hr run (paper + ink) = cost of 5 sequencers (Illumina NextSeq500)

| 11 Data Generation and Analysis CropsBacteriaFungiWeedsInsects Baseline genomic information Multi-sample experimentsSample specific data (“assays”) Meta analyses

| 12 Worldwide scope North America 33 Pacific 4 Latin America 10 Europe 14

| 13 What kind of genomic information do we use most? Functional Genomics: Understanding processes within the organism(s). Identify functional elements within genome that are involved in a given process or response. Transcriptomics, epigenomics, etc. Images by: Clemens82 (Own work) CC-BY-SA-3.0, via Wikimedia Commons; & NHGRI Structural Genomics: Understanding genetic & genomic architecture of a species Characterizing variation within populations Tracking inheritence of genome segments Re-sequencing, variant detection, structural variation

| 14 Where has Genomics Made the Biggest Impact? Reference Genomes: Baseline information resource has become a must-have tool for every organism. Browseable, searchable and with links to other databases. (e.g. gbrowse, ensembl) Variant Discovery & Detection: Easy discovery of variation with NGS ensured rapid adoption. Significant scale & precision improvements over hybridization. Accelerating Discovery & Curiosity Low cost experiments remove barriers to asking questions. Discovery is accelerated.

| 15 Area of biggest future impact - Breeding At its core, plant breeding is: Introduce Variation Select best individuals By Phenotype (e.g. Yield trials) Phenotype prediction from genotypic informaiton Uncharacterized variation Genomic variation fully characterized “The future of crop improvement will be centered on comparisons of new genetic mapping strategies and evolutionary analyses to direct and optimize the discovery and use of genetic variation” Morrell et al., (2012) Nature Reviews Genetics 13:85-96.

| 16 Challenges Infrastructure -Storage and Compute – must haves for modern biology -Data management strategies. Finding and connecting data. People -More ‘Digital Biologists’ need to be trained -More ‘Bio-Savvy Computer Scientists’ need to be trained Human-centric technology development -95% of all genome technology is driven by medicine apps. -Acceptable cost for a human genome is too high for Ag.

| 17 Genomic Tech & Info are a critical component in meeting the challenges of the growing world. By 2050, world food production must support an estimated 9 billion people. The growing world needs ongoing innovations in crop production technology. We are committed to developing sustainable agricultural solutions that make farming more profitable and productive.