1. Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of migratory structures compared to vector control. Phase contrast image of cultured MCF7/Vec and MCF7/S100A7 cells taken at 10x magnification. Inset image shows the representative zoomed area. Supp Fig 2. S100A7-overexpression in MCF7 cells down-regulate genes which are involved in cancer pathways. Total RNA from MCF7/Vec and MCF7/S100A7 cells were analyzed by Affymetrix Human Genome U133 chip. (A) Gene ontology studies using IPA analysis of microarray data. (B) Heat-map of differentially expressed genes in MCF7/Vec and MCF7/S100A7 cells showing reduced expression of β-catenin/TCF4 pathway genes. Supp Fig 3. Expression of estrogen receptor alpha (ERα) in S100A7-overexpressing and vector control MCF7 and T47D cells. 50 μg cell lysates of MCF7/Vec, MCF7/S100A7, T47D/Vec and T47D/S100A7 cells were subjected to Western blotting with ERα antibody. GAPDH was used as a loading control in all the blots.

2. 2 Supplementary figures GenePrimer sequence GSK3β Forward (5’ GGTCTATCTTAATCTGGTGCTGG 3’) Reverse (5’ TGGATATAGGCTAAACTTCGGAAC 3’) Cyclin D1 Forward (5’ TATTGCGCTGCTACCGTTGA 3’) Reverse (5’ CCAATAGCAGCAAACAATGTGAAA 3’) E-cadherin Forward (5’ AGGCCAAGCAGCAGTACATT 3’) Reverse (5’ ATTCACATCCAGCACATCCA 3’) β-catenin Forward (5’ GCTGGGACCTTGCATAACCTT 3’) Reverse (5’ ATTTTCACCAGGGCAGGAATG 3’) GAPDH Forward (5’ ACCCACTCCTCCACCTTTG 3’) Reverse (5” CTCTTGTGCTCTTGCTGGG 3’) Table 1. List of primers used for Real Time – PCR

3. 3 MCF7/VecMCF7/S100A7 Supp. Fig. 1

4. 4 Supp. Fig. 2. TCF7L2 DVL2 DVL3 APC CCND1 ANAPC5 GSK3β DVL2 AXON1 CTNNB1 ANAPC4 10.0 7.0 4.0 MCF7/Vec MCF7/S100A7 A B

5. 5 Vec S100A7 MCF7 ER-α GAPDH ER-α GAPDH Vec S100A7 T47D Supp. Fig. 3.