1. Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was performed with a rabbit anti-KLF4 antibody using a standard protocol. Shown were representative images of KLF4 staining in human normal skin tissue (left), tumor tissue of SCC from cheek (middle) and BCC from face (right). Scale bars, 50 µm.

2. Supplementary Fig 1B Normal skin tissue

3. Supplementary Fig 2B The MTT assay was performed using KLF4 stable knockdown (shKLF4) and control (shCon) A431 cells. The data was analyzed similarly as described in the main text.

4. Supplementary Fig 3C

5. Supplementary Fig 4A

6. Supplementary Fig 4B

7. Supplementary Fig 4D

8. Supplementary Fig 5 Down regulation of p21 expression in tumors derived from KLF4 knockout mice. Skin tumor tissues from control mice (KLF4+/+) and KLF4 knockout mice (KLF4-/-) were extracted, followed by RNA preparation and quantitative RT-PCR analysis using KLF4 and p21 primers. Relative mRNA levels were normalized to that of GAPDH. Three mice were used for each group. Mouse p21 RT primers: forward: 5’ CGTGGCCTTGTCGCTGTCTT 3’. Reverse: 5’ GCTGGTCTGCCTTTTTC 3’. Mouse KLF4 RT primers: forward: 5’ CCGGCGGGAAGGGAGAAGA 3’. Reverse: 5’ GCTAGGAGGGCCGGGTTGTTAC 3’. Mouse GAPDH RT primers: forward: 5’ AGGCCGGTGCTGCTGAGTATGTC 3’. Reverse: 5’ CAGAAGGGGCGGAGATGAT 3’. Relative mRNA levels