Presentation is loading. Please wait.

Presentation is loading. Please wait.

Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29.

Published byTheresa Preston Modified over 8 years ago

Similar presentations

Presentation on theme: "Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29."— Presentation transcript:

1 Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29

2 Analysis of Beclin1, ATG3 and LC3B mRNA expression by real-time quantitative PCR After appropriate treatments to HCT-116 and HT-29 cells in 6-well plates, RNA was extracted by using TRIzol (Invitrogen,15596-026), and 500ng of RNA was reverse-transcribed to cDNA. The following Primers were used to amplify Beclin1, ATG3 and LC3B products as well as GAPDH as housekeeping control. Primer sequences and their respective PCR fragment lengths for real-time quantitative PCR were as follows: Beclin1 :forward 5’-AGGTTGAGAAAGGCGAGACA-3’ and reverse 5’-ACTGCCTCCTGTGTCTTCAA - 3’. ATG3 :forward 5’-AAGTGGCTGAGTACCTGACC-3’ and reverse 5’-GATCTCCAGCTGCCACAAAC-3’. LC3B :forward 5’-CGCACCTTCGAACAAAGAGT-3’ and reverse 5’-AGCTGCTTCTCACCCTTGTA-3’. GAPDH :forward 5’-CAAATTCCATGGCACCGTCA-3’ and reverse 5’-ATCTCGCTCCTGGAAGATGG-3’. Beclin1, ATG3 and LC3B mRNA level was determined by using PrimeScript RT reagent Kit (Perfect Real Time) (TAKARA, RR037A) Fig. S1

3 Protein Name Gene NameGene ID Primers Beclin1BECN18678forward 5’- AGGTTGAGAAAGGCGAGACA-3’ and reverse 5’- ACTGCCTCCTGTGTCTTCAA - 3’. ATG3 64422forward 5’- AAGTGGCTGAGTACCTGACC-3’ and reverse 5’- GATCTCCAGCTGCCACAAAC-3’. LC3BMAP1LC3B81631forward 5’- CGCACCTTCGAACAAAGAGT-3’ and reverse 5’- AGCTGCTTCTCACCCTTGTA-3’. GAPDH 2597forward 5’- CAAATTCCATGGCACCGTCA-3’ and reverse 5’- ATCTCGCTCCTGGAAGATGG-3’. Fig. S1

Download ppt "Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29."

Similar presentations

Printed by www.postersession.com Investigation of Possible Second Promoter in Cd4 through Comparison of the Relative Abundance of Transcripts Colby Uptegraft.

Printed by Investigation of Possible Second Promoter in Cd4 through Comparison of the Relative Abundance of Transcripts Colby Uptegraft.
RT-PCR lab You have a cell…is a certain gene on (by “on,” we mean active and producing mRNA?)? If a certain gene is on when the cell divides, the gene.

RT-PCR lab You have a cell…is a certain gene on (by “on,” we mean active and producing mRNA?)? If a certain gene is on when the cell divides, the gene.
Applied Biosystems 7900HT Fast Real-Time PCR System I. Real-time RT-PCR analysis of siRNA-induced knockdown in mammalian cells (Amit Berson, Mor Hanan.

Applied Biosystems 7900HT Fast Real-Time PCR System I. Real-time RT-PCR analysis of siRNA-induced knockdown in mammalian cells (Amit Berson, Mor Hanan.
Analysis of Gene Expression - Overview -

Analysis of Gene Expression - Overview -
Site Protocol component 1234567891011121314151617181920212223 NMD inhibitor Cyclo- heximide 100  g/ml 4hrs no cell culture Cyclo- heximide 100  g/ml.

Site Protocol component NMD inhibitor Cyclo- heximide 100  g/ml 4hrs no cell culture Cyclo- heximide 100  g/ml.
Polymerase Chain Reaction WORKSHOP (3)

Polymerase Chain Reaction WORKSHOP (3)
Supplementary Online Information. SOI Fig 1 Preliminary microarray data on dysregulation of angiogenic proteins by butyrate In a preliminary experiment,

Supplementary Online Information. SOI Fig 1 Preliminary microarray data on dysregulation of angiogenic proteins by butyrate In a preliminary experiment,
Analyzing your clone 1) FISH 2) “Restriction mapping” 3) Southern analysis : DNA 4) Northern analysis: RNA tells size tells which tissues or conditions.

Analyzing your clone 1) FISH 2) “Restriction mapping” 3) Southern analysis : DNA 4) Northern analysis: RNA tells size tells which tissues or conditions.
Idenfitied Differentially Expressed Genes in Keratoconus

Idenfitied Differentially Expressed Genes in Keratoconus
How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?

How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?
 Isolate a specific gene of interest  Insert into a plasmid  Transfer to bacteria  Grow bacteria to get many copies  Express the protein product 

 Isolate a specific gene of interest  Insert into a plasmid  Transfer to bacteria  Grow bacteria to get many copies  Express the protein product 
Expression of the Genome The transcriptome. Decoding the Genetic Information  Information encoded in nucleotide sequences contained in discrete units.

Expression of the Genome The transcriptome. Decoding the Genetic Information  Information encoded in nucleotide sequences contained in discrete units.
-4.5 -4 -3.5 -3 -2.5 -2 -1.5 -0.5 0 05101520 Ct log DNA （ pmol) P1P2 Supplementary Fig. S1 Standard curve of the PCR amplification efficiency of transcripts.

Ct log DNA （ pmol) P1P2 Supplementary Fig. S1 Standard curve of the PCR amplification efficiency of transcripts.
Supplementary Figure 1. Compararison of the expression of the genes within the 10q23 locus using either Troglitazone or Rosiglitazone as the PPAR  agonist.

Supplementary Figure 1. Compararison of the expression of the genes within the 10q23 locus using either Troglitazone or Rosiglitazone as the PPAR  agonist.
Supplementary Figures Fig. 1 Transcript levels of Tissue Factor, PAR-1 and PAR-2 Expression if TF, PAR-1 and PAR-2 was analyzed in unstimulated HUVECs,

Supplementary Figures Fig. 1 Transcript levels of Tissue Factor, PAR-1 and PAR-2 Expression if TF, PAR-1 and PAR-2 was analyzed in unstimulated HUVECs,
Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.
【 Supplement methods 】 Real-Time Reverse Transcription-PCR Total RNA was isolated from HRGEc using the RNeasy® Mini Kit. cDNA was synthesized using Super-Script®

【 Supplement methods 】 Real-Time Reverse Transcription-PCR Total RNA was isolated from HRGEc using the RNeasy® Mini Kit. cDNA was synthesized using Super-Script®
Supplemental Table 1 Source and authentication of cell lines.

Supplemental Table 1 Source and authentication of cell lines.
Topic Cloning and analyzing oxalate degrading enzymes to see if they dissolve kidney stones with Dr. VanWert.

Topic Cloning and analyzing oxalate degrading enzymes to see if they dissolve kidney stones with Dr. VanWert.
Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was.

Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was.

Similar presentations

Ads by Google