1. 1 LAB: Extract your DNA

2.  DNA?  Where is it located?  What is the shape?  What has DNA? Deoxyribonucleic Acid Nucleus Living Organisms Double Helix

3.  20th century – Major challenge: What arethe molecules of inheritance?  T. H. Morgan’s group showed that genes are located on chromosomes  The 2 components of chromosomes—DNA and protein— became candidates for the genetic material  1928 - Frederick Griffith discovered of the genetic role of DNA by working with two strains of a bacterium, one pathogenic and one harmless.

4.  It was known that DNA is a polymer of nucleotides, each consisting of a nitrogenous base, a sugar, and a phosphate group  In 1950, Erwin Chargaff reported that DNA composition varies from one species to the next phosphate group deoxyribose (sugar) nitrogen-containing base

5.  New Challenge: What is the structure of DNA?  Maurice Wilkins and Rosalind Franklin (King’s College) were using a technique called X-ray crystallography to study structure  Franklin produced a picture of the DNA molecule using this technique (photo 51)

6.  1953 – Watson and Crick (Cambridge University) saw Photo 51 and discovered the structure of DNA.  Double Helix – long twisted zipper Segment with James Watson

7.  The double helix of a chromosome is so thin that it only be detected through innovative, high-tech procedures.  Chromosomal DNA from a single cell is not visible to the naked eye.  However, when chromosomal DNA is extracted from multiple cells, the DNA can be seen.  We will collect cheek cells.  Then, we will lyse the cell membranes by adding a detergent. (This allows the DNA to be freed.)  DNA is soluble in water, but much less soluble in alcohol. Thus, alcohol will be slowly added, and DNA will precipitate to the sports drink/alcohol interface, and you will be able to see your own DNA!

8.  Read Molecular structure of Nucleic Acids

9.  DNA is made of nucleotides of  Deoxyribose (sugar)  PO 4 (phosphate group)  Nitrogen bases  1. adenine—A  2. guanine—G  3. thymine—T  4. cytosine—C phosphate group deoxyribose (sugar) nitrogen-containing base

10.  Double ring PURINES Adenine (A) Guanine (G)  Single ring PYRIMIDINES Thymine (T) Cytosine (C) T or C A or G

11. hydrogen bond covalent bond  A bonds to T with 2 hydrogen bonds  G bonds to C with 3 hydrogen bonds

12.  DNA makes a copy of DNA  Where? In the nucleus  Semiconservative Replication  Parental strands separate and serve as templates  New DNA have one parent strand and one new strand

13.  Step 1 – DNA helicase breaks the H+ bonds between the nitrogen bases (un-zipping DNA)  Step 2 – Free floating nucleotides in the cell bond to the complementary bases on the original strands  Step 3 – An enzyme secures the two strands together, forming two new chains DNA replication animation

14.  Replication occurs in 3’ to 5’ direction.  DNA polymerase adds the nucleotides  Two strands:  Leading Strand  Lagging Strand –  Okazaki fragments  DNA replication animation DNA replication animation

15.  CGATATATTCCCGAG  ATTCAGTTCAGACCC  ACGTTATACGCTAAC

16. Central Dogma DNA RNA PROTEIN

17.  DNA RNA  Where? In the nucleus  animation animation

18. 1. 1.RNA has a sugar ribose DNA has a sugar deoxyribose 2.RNA contains the base uracil (U) DNA has thymine (T) 3.RNA molecule is single-stranded DNA is double-stranded 18

19.  CGATATATTCCCGAG  ATTCAGTTCAGACCC  ACGTTATACGCTAAC

20.  Messenger RNA (mRNA) - carries genetic information  Ribosomal RNA (rRNA) - makes the ribosomes  Transfer RNA (tRNA) - transfers amino acids to the ribosomes where proteins are made 20.

21. MESSENGER RNA (MRNA) 21 AUGGGCUCCAUCGGCGCAUAA mRNA start codon codon 2codon 3codon 4codon 5codon 6codon 7codon 1 mRNA has a code (codon) for tRNA

22.  RNA protein  Where? In cytoplasm.  The chain of amino acids linked together is a specific protein.  animation animation

23.  GCUAUAUAAGGGCUC  UAAGUCAAGUCUGGG  UGCAAUAUGCGAUUG

24. 24 amino acid attachment site AAG anticodon Phenylalanine amino acid

25.  GCUAUAUAAGGGCUC  UAAGUCAAGUCUGGG  UGCAAUAUGCGAUUG

26.  Given the following DNA sequence  CGATATATTCCCGAG  1. What is the complimentary DNA?  2. What is the mRNA strand (codon)?  3. What amino acids are created?  4.What is the tRNA (anticodon)?

27.  MUTATION-error  Substitutions  Insertions  Deletions  Frameshift  Translocation  Inversion  Not all are harmful  Read Happy Birthday Double Helix

29.  CCATAT CATGGC  CCA TAT GCA TGG C

31.  Original:  The fat cat ate the wee rat.  Frame Shift (“a” added):  The fat caa tet hew eer at.

32.  CCC GCG ATT TAT  CCC TAT ATT GCG