Download presentation
Presentation is loading. Please wait.
Published byKory Anderson Modified over 8 years ago
1
Gene Therapy is the Path to a Cure Keith R. Jerome, MD, PhD Fred Hutchinson Cancer Research Center Seattle, Washington USA
2
Timothy Brown Why gene therapy? HIV is a genetic disease Cure is a matter of specificity
3
The specificity problem Any approach targeting epigenetic modification will have significant effects on cellular gene regulation What is needed is the ability to specifically target and modify critical gene sequences DNA ATCGGAGCATCCGATATCGGAGCATCCGAT
4
Targeted DNA editing enzymes provide the needed specificity Specifically recognize and alter desired DNA sequences, while leaving other sequences intact Homing endonucleases recognition site: 22 bp 4 22 > 17x10 12 >>> 3x10 9
5
Approaches to HIV Gene Therapy CCR5 modification T cells, stem cells Other modifications of hematopoietic cells entry inhibitors, siRNA Direct targeting of integrated virus Tilton and Doms, 2010
6
Research agenda to bring this to reality Further development and testing of specifically targeted, non-toxic DNA modifying enzymes Identification of the highest yield cellular targets for modification Techniques for modification and reintroduction of stem cells, without the need for toxic conditioning regimens Development of highly efficient delivery vectors
7
Why gene therapy? Principle has been proven in the only HIV cure to date New breakthroughs in DNA targeting enzymes and stem cell biology mean that all the needed tools are now in hand Gene Therapy is the Path to a Cure
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.