Presentation is loading. Please wait.

Presentation is loading. Please wait.

1 Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies.

Similar presentations


Presentation on theme: "1 Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies."— Presentation transcript:

1 1 Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies and Rabies-Related Viruses

2 2 Introduction Rabies is endemic within many countries of south east Europe The fox is the principal reservoir species but dog rabies cases still reported Few epidemiological studies reported from the region Identify factors that contribute to epidemiology Lack of knowledge hampers vaccination programmes

3 3 Southeast Europe (the Balkans)

4 4 The Balkan Peninsular Turkey Bulgaria Romania Bosnia and Herzegovina Ukraine Czech Republic Greece Poland Russia Slovakia Hungary Austria Croatia Slovenia Albania Serbia Mac

5 5 Cohort Details Country (Cases 2005)FoxDogJackalHumanOtherNot recorded [Total] Bosnia-Herzegovina (36) Bulgaria (8) Georgia11 Serbia & Montenegro (101)22 Hungary (9)3115 Poland (138)22 Romania (530) Russia (3087)3115 Slovak Republic (50)11 Turkey (193)

6 6 Isolate details Code No.CountryRegionSpeciesYearGenbank Accession Number 5BulgariaLovechFox2003DQ RomaniaIolomitaFox?- RV1124TurkeyManisaFox2000AY091610

7 7 Region of the Genome 327 nucleotides TTATCGTGGATCAATATGAGTACAAGTACCCTGCCATCAAAGATTTGAAAAAGCCCTGTATAACTCTAGGAAAGGCTCCC GATTTAAATAAAGCATACAAGTCAGTTTTATCATGCATGAGCGCCGCCAAACTTGATCCTGACGATGTATGTTCCTATTT GGCGGCGGCAATGCAGTTTTTTGAGGGGACATGTCCGGAAGACTGGACCAGCTATGGAATCGTGATTGCACGAAAAGGAG ATAAGATCACCCCAGGTTCTCTGGTGGAGATAAAACGTACTGATGTAGAAGGGAATTGGGCTCTGACAGGAGGCATGGAA CTGACAAGAGACCCCAC NPMGL

8 8 Phylogenetic analysis of RABV sequences from Southeastern Europe SAD B19 Pasteur Bosnia-Herzegovina Western Turkey Romania / Russia Romania Bulgaria Eastern Turkey

9 9 Phylogenetic tree of Eastern European Isolates Eastern Romania / Russia Central Romania Wave 1: Western Turkey Western Turkey Bosnia-Herzegovina Outgroup Bulgaria * * * * * * * * * * * * * * * * * * 0.01 substitutions / site * Bootstrap values > 700

10 10 Romania Romania / Russia Romania / Poland

11 11 Bulgaria Targovishte Dobrich Lovech Montana Pleven Lovech Former Yugoslavia Vidin Montana

12 12 Bosnia-Herzegovina Hungary

13 13 Conclusions Most isolates fall into the East European group of viruses Geography dominates isolate clustering Topography may play a significant role in preventing spread of fox-rabies The Danube appears to block movement between Romania and Bulgaria Such factors could assist in future vaccination campaigns

14 14 Acknowledgements Co-Authors Veterinary Laboratories Agency (UK)AR Fooks FLI-Wusterhausen (Germany)T Muller, C Freuling IDT (Germany)A Vos Etlik CVRI (Turkey)O Aylan H Un Natl. Diag. & Res Vet Inst (Bulgaria)R Valtchovski Inst. Diag. & Animal Health (Romania)M Turcitu F Dumistrescu V Vlad Univ. Sarajevo (Bosnia-Hervegovina)R Velic Vet. Inst. Of Republika of SrpskaV Sandrac Funding Defra (UK)


Download ppt "1 Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies."

Similar presentations


Ads by Google