Presentation is loading. Please wait.

Presentation is loading. Please wait.

Acc414 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc420 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA---

Similar presentations


Presentation on theme: "Acc414 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc420 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA---"— Presentation transcript:

1 Acc414 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc420 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc761 (i, Hai-Nan-Tao) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc108 (i, Taiwan) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc130 (i, Taiwan) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc504 (j, Taiwan) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc563 (j, Japan) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc709 (j, Central China) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc710 (i, Central China) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc719 (i, Central China) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc729 (i, South China) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc757 (j, Hai-Nan-Tao) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc848 (j, Mountains of Taiwan) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- AccUp1 (j, Japan) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- AccUp3 (j, Japan) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc201 (j, Philippines) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc220 (j, Philippines) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc224 (j, Philippines) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc206 (j, Philippines) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc1 (i, Vietnam) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc718 (j, Central China) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc101 (i, Taiwan) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc440 (i, India) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc868 (i, Mountains of Taiwan) TTGGACCTTGAAGATAATATCGGTATAGAGGACTCCCACCTGAAGAAGATATGTGAG--- Acc715 (i, Central China) TTGGACCTTGAAGACAATCTCGATATAGATGACTCTCACCTGAAGAAGATATGTGAG--- Acc724 (i, South China) TTGGACCTTGAAGACAATCTCGATATAGATGACTCTCACCTGAAGAAGATATGTGAG--- Acc706 (i, North China) TTGGACCTTGAAGACAATCTCGATATAGATGACTCTCACCTGAAGAAGATATGTGAG--- Acc624 (j, Celebes Is.) TTGGACCTTGAAGACAATCTCGATATAGATGACTCTCACCTGAAGAAGATATGTGAG--- Acc421 (i, India) TTGGATCTTGAAGGAAATAAGGATATACTGAACTCTCACCTGCAGGATATATGTGAATGT Acc642 (j, Celebes Is.) TTGGATCTTGAAGGAAATAAGGATATACTGAACTCTCACCTGCAGGATATATGTGAATGT AccUp4 (j, Japan) TTGGATCTTGAAGGAAATAAGGATATACTGAACTCTCACCTGCAGGATATATGTGAATGT Acc708 (j, North China) TTGGATCTTGAAGGAAATAAGGATATACTGAACTCTCACCTGCAGGATATATGTGAATGT ***** ******* *** * **** * ** ** *** ** ******** Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA Acc CAGTTA---AGCCTCAGAGTG---AGGTACCTTGGTCTCAAGGGAACGCGGATCCGA AccUp1 ---CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT AccUp3 ---CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc1 ---CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTAGGTCTCAAGGGTACGCGAATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTGGGTATCAAGGGTACACGGATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTGGGTATCAAGGGTACACGGATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTGGGTATCAAGGGTACACGGATCACT Acc CAGCTAGAGAGCCTCAGGCTGCTCAAGTACCTGGGTATCAAGGGTACACGGATCACT Acc421 GAGCAGTTA---AGCTTCAGGCTG---AGCTACCTGTGTCTAAAGGGGACTGGGATCACT Acc642 GAGCAGTTA---AGCTTCAGGCTG---AGCTACCTGTGTCTAAAGGGGACTGGGATCACT AccUp4 GAGCAGTTA---AGCTTCAGGCTG---AGCTACCTGTGTCTAAAGGGGACTGGGATCACT Acc708 GAGCAGTTA---AGCTTCAGGCTG---AGCTACCTGTGTCTAAAGGGGACTGGGATCACT *** ** *** **** ** * ***** ** * ***** ** * *** Fig. S2a. DNA sequence alignment of the Pikm1-TS LRR region in set 2 lines. In parentheses, indica (i) and japonica (j) origins are followed by geographic origin of line. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2a (1/5)

2 Acc414 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc420 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc761 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc108 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc130 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc504 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc563 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc709 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc710 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc719 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc729 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc757 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT Acc848 AAGCTCCCTCAGGAGATGAGGAAGCTGAAGCATTTGGAGATTTTGTATGTGGGGAGCACT AccUp1 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA AccUp3 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc201 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc220 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc224 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc206 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc1 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc718 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc101 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTGGAGATTTTGTACGTGAGGAGCACA Acc440 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTAGAGATTTTGTACGTGAGGAGCACA Acc868 AAGCTCCCACAGGAGATACAGAAGCTGAAGCAACTAGAGATTTTGTACGTGAGGAGCACA Acc715 AAGCTCCCACAGGAGATACAGAAGCTGAAGCATCTGGAGATTTTGTACGTGAGGAGCACA Acc724 AAGCTCCCACAGGAGATACAGAAGCTGAAGCATCTGGAGATTTTGTACGTGAGGAGCACA Acc706 AAGCTCCCACAGGAGATACAGAAGCTGAAGCATCTGGAGATTTTGTACGTGAGGAGCACA Acc624 AAGCTCCCACAGGAGATACAGAAGCTGAAGCATCTGGAGATTTTGTACGTGAGGAGCACA Acc421 AAGCTCCCACGAGAGATCGGGAAGCTCAAGCATCTGGAGATTTTGTACGTGGGGAACACA Acc642 AAGCTCCCACGAGAGATCGGGAAGCTCAAGCATCTGGAGATTTTGTACGTGGGGAACACA AccUp4 AAGCTCCCACGAGAGATCGGGAAGCTCAAGCATCTGGAGATTTTGTACGTGGGGAACACA Acc708 AAGCTCCCACGAGAGATCGGGAAGCTCAAGCATCTGGAGATTTTGTACGTGGGGAACACA ******** * ***** ****** ***** * *********** *** *** *** Acc414 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc420 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc761 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc108 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc130 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc504 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc563 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc709 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc710 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc719 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc729 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc757 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG Acc848 CGGATCAGTGAACTTCCGCAAGAGATTGGAGAGCTGAAGCATCTGCGGATTCTGGACGTG AccUp1 GGCATCGAAGAGCTCCCATGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG AccUp3 GGCATCGAAGAGCTCCCATGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc201 GGCATCGAAGAGCTCCCATGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc220 GGCATCGAAGAGCTCCCATGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc224 GGCATCGAAGAGCTCCCATGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc206 GGCATCGAAGAGCTCCCATGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc1 GGCATCAAAGAGCTCCCACGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc718 GGCATCGAAGAGCTCCCACAGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc101 GGCATCGAAGAGCTCCCACAGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc440 GGCATCAAAGAGCTCCCACGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc868 GGCATCAAAGAGCTCCCACGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACGTG Acc715 GGCATCAAAGAGCTCCCACGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACATG Acc724 GGCATCAAAGAGCTCCCACGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACATG Acc706 GGCATCAAAGAGCTCCCACGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACATG Acc624 GGCATCAAAGAGCTCCCACGGGAGATCGGGGAATTGAAACAACTGCGGACTCTGGACATG Acc421 AAGATCAGTGACCTTCCACAGGAGATCGGGGAGCTCAAACATCTGCAGACTTTGGACGTG Acc642 AAGATCAGTGACCTTCCACAGGAGATCGGGGAGCTCAAACATCTGCAGACTTTGGACGTG AccUp4 AAGATCAGTGACCTTCCACAGGAGATCGGGGAGCTCAAACATCTGCAGACTTTGGACGTG Acc708 AAGATCAGTGACCTTCCACAGGAGATCGGGGAGCTCAAACATCTGCAGACTTTGGACGTG *** ** ** ** ***** ** ** * ** ** **** ** * ***** ** Fig. S2a. DNA sequence alignment of the Pikm1-TS LRR region in set 2 lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2a (2/5)

3 Acc414 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc420 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc761 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc108 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc130 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc504 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc563 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc709 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc710 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc719 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc729 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc757 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT Acc848 AGAAACACGGACATCACTGAGCTCCCACTGCAGATACGGGAGCTGCAGCATCTGCACACT AccUp1 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT AccUp3 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc201 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc220 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc224 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc206 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc1 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc718 AGGAACACGCAGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc101 AGGAACACGCAGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc440 AGGAACACGCGGATCAGTGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc868 AGGAACACGCGGATCAGTGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc715 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc724 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc706 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc624 AGGAACACGCGGATCAGCGAGCTCCCGTCGCAGATCGGGGAGCTCAAACATCTGCGGACT Acc421 GGTGGCACGGATATCCGCGAGCTCCCACCACAGATAGGGGAGCTGAACAATCTGCGGACT Acc642 GGTGGCACGGATATCCGCGAGCTCCCACCACAGATAGGGGAGCTGAACAATCTGCGGACT AccUp4 GGTGGCACGGATATCCGCGAGCTCCCACCACAGATAGGGGAGCTGAACAATCTGCGGACT Acc708 GGTGGCACGGATATCCGCGAGCTCCCACCACAGATAGGGGAGCTGAACAATCTGCGGACT * **** *** ******** ***** ******* * ****** *** Acc414 CTGGACGTGAGGAACA------CGCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc420 CTGGACGTGAGGAACA------CGCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc761 CTGGACGTGAGGAACA------CGCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc108 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc130 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc504 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc563 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc709 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc710 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc719 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc729 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc757 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT Acc848 CTGGACGTGAGGAACA------CTCCAATCAGTGAGCTCCCGCCGCAGGTTGG-CAAGCT AccUp1 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT AccUp3 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc201 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc220 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc224 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc206 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc1 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTTGCAAATCGG-GGAGCT Acc718 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc101 CTGGACGTGAGTAACA---TGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc440 CTGGACGTGAGTAACA---TGTGGAATATCAGCAAGCTGCCGTCGCAAATCGG-GGAGCT Acc868 CTGGACGTGAGTAACA---TGTGGAATATCAGCAAGCTGCCGTCGCAAATCGG-GGAGCT Acc715 CTGGACGTGAGTAACAACATGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc724 CTGGACGTGAGTAACAACATGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc706 CTGGACGTGAGTAACAACATGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc624 CTGGACGTGAGTAACAACATGTGGAATATCAGCGAGCTGCCGTCGCAAATCGG-GGAGCT Acc421 TTGGACGTGAGGAACA------CGAGGGTGAGAGAGCTGCCATGGCAAGCTGGACAGATC Acc642 TTGGACGTGAGGAACA------CGAGGGTGAGAGAGCTGCCATGGCAAGCTGGACAGATC AccUp4 TTGGACGTGAGGAACA------CGAGGGTGAGAGAGCTGCCATGGCAAGCTGGACAGATC Acc708 TTGGACGTGAGGAACA------CGAGGGTGAGAGAGCTGCCATGGCAAGCTGGACAGATC ********** **** * ** **** ** *** ** Fig. S2a. DNA sequence alignment of the Pikm1-TS LRR region in set 2 lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2a (3/5)

4 Acc414 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc420 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc761 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc108 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc130 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc504 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc563 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc709 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc710 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc719 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc729 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc757 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT Acc848 GCAGAATCTCAAGATTATGTGCGTGAGGAGCACTGGGGTTAGGGAGCTCCCAAAGGAGAT AccUp1 GAAGCATCTACAAACTCTGGATGTGAGGAACACGTCAGTGAGAGAGCTGCCATCGCAAAT AccUp3 GAAGCATCTACAAACTCTGGATGTGAGGAACACGTCAGTGAGAGAGCTGCCATCGCAAAT Acc201 GAAGCATCT Acc220 GAAGCATCTACAAACTCTGGATGTGAGGAACACGTCAGTGAGAGAGCTGCCATCGCAAAT Acc224 GAAGCATCT Acc206 GAAGCATCT Acc1 GAAGCATCTACAAACTCTGGATGTGAGGAACACGTCAGTGAGAGAGCTGCCATCGCAAAT Acc718 GAAGCATCTACAAACTCTGGATGTGAGGAACACGTCAGTGAGAGAGCTGCCATCGCAAAT Acc101 GAAGCATCT Acc440 AAAGCATCT Acc868 AAAGCATCT Acc715 GAAGCATCTACAAACTCTGGATGTGAGGAATACGTCGGTGAGAGAGCTGCCATCGCAAAT Acc724 GAAGCATCTACAAACTCTGGATGTGAGGAATACGTCGGTGAGAGAGCTGCCATCGCAAAT Acc706 GAAGCATCT Acc624 GAAGCATCT Acc421 TCCGAATCACTGCGC-GTGCTTTTAGGCGACAAATCAGATAGCGTGCAGGTGCAGGTGCC Acc642 TCCGAATCACTGCGC-GTGCTTTTAGGCGACAAATCAGATAGCGTGCAGGTGCAGGTGCC AccUp4 TCCGAATCACTGCGC-GTGCTTTTAGGCGACAAATCAGATAGCGTGCAGGTGCAGGTGCC Acc708 TCCGAATCACTGCGC-GTGCTTTTAGGCGACAAATCAGATAGCGTGCAGGTGCAGGTGCC * *** Acc414 TGGGGAGCTGAATCATCTACAGATTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc420 TGGGGAGCTGAATCATCTACAGATTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc761 TGGGGAGCTGAATCATCTACAGATTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc108 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc130 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc504 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc563 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc709 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc710 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc719 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc729 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc757 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC Acc848 TGGGGAGCTGAATCATCTACAGACTCTGGACGTGAGAAACACGAGGGTGAGAGAGCTGCC AccUp1 CGGGGAGCTGAAGCATCTGCGGTCTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC AccUp3 CGGGGAGCTGAAGCATCTGCGGTCTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc220 CGGGGAGCTGAAGCATCTGCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc1 CGGGGAGCTGAAGCATCTGCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc718 CGGGGAGCTGAAGCATCTGCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGAGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGAGGGTGAGAGAGCTGCC Acc715 CGGGGAGCTGAAGCATCTGCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc724 CGGGGAGCTGAAGCATCTGCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc GCGGACTCTGGATGTGAGGAACACGGGGGTGAGAGAGCTGCC Acc421 TGAGGG CGTCAACAAA-----GATCTGGTAAA-ACATATTCCAGAGCATT-T- Acc642 TGAGGG CGTCAACAAA-----GATCTGGTAAA-ACATA----GGAGTATT-CC AccUp4 TGAGGG CGTCAACAAA-----GATCTGGTAAA-ACATA----GGAGTATT-CC Acc708 TGAGGG CGTCAACAAA-----GATCTGGTAAA-ACATA----GGAGTATT-CC * ** ** ** ** *** * Fig. S2a. DNA sequence alignment of the Pikm1-TS LRR region in set 2 lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2a (4/5)

5 Acc414 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc420 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc761 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc108 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc130 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc504 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc563 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc709 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc710 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc719 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc729 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc757 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG Acc848 ATGGCAAGCTGGCCAGATCTCCCAATCGTTGCGCGTGCTTGCCGGTGACAGTGGCGATGG AccUp1 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG AccUp3 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc201 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc220 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc224 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc206 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc1 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc718 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc101 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc440 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc868 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc715 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc724 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc706 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc624 ATGGCAAGCTGGCCAGATCTCGGGATCGCTGCACGTGCATACAGATGACAGTGACGAGGG Acc GCTTGCAAACTCAAC--CCTATCCATCGCG-AT---TCTCGATCGTTTTG-----GA Acc642 AGAGCTTGCAAACTCAAC--CCTATCCATCGCG-AT---TCTCGATGGTTTTG-----GA AccUp4 AGAGCTTGCAAACTCAAC--CCTATCCATCGCG-AT---TCTCGATGGTTTTG-----GA Acc708 AGAGCTTGCAAACTCAAC--CCTATCCATCGCG-AT---TCTCGATGGTTTTG-----GA ** ** * * * * ** * * * * ** * Acc414 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc420 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc761 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc108 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc130 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc504 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc563 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc709 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc710 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc719 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc729 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc757 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA Acc848 CGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTCTGATCAACGGTATTCCA AccUp1 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC AccUp3 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc201 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCA Acc220 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCA Acc224 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc206 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc1 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc718 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc101 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc440 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc868 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc715 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc724 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc706 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc624 CATGCGGCTGCCAGAAGGCGTATGCGAAGATCTGATCAAGGGTATTCCC Acc421 CCTCCCCTTGTTGGGA----TATTCAAGGTTCTAGGCAGGAACGTACGT Acc642 CCTCCCCTTGTTGGGA----CATTCAAGGTTCTAGGCAGGAACGTACGT AccUp4 CCTCCCCTTGTTGGGA----CATTCAAGGTTCTAGGCAGGAACGTACGT Acc708 CCTCCCCTTGTTGGGA----TATTCAAGGTTCTAGGCAGGAACGTACGT * * * ** * * * * * * *** ** * * Fig. S2a. DNA sequence alignment of the Pikm1-TS LRR region in set 2 lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2a (5/5)

6 Acc440 (i, India) CTAAAACGGATCAATAGTATACTTGGAGGGAACAAAAAAACACGGGAGGGGCTGAGGTTG Acc868 (i, Mountains of Taiwan) CTAAAACGGATCAATAGTATACTTGGAGGGAACAAAAAAACACGGGAGGGGCTGAGGTTG Acc101 (i, Taiwan) CTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGTTGAGGTTG Acc706 (i, North China) CTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGTTGAGGTTG Acc715 (i, Central China) CTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGTTGAGGTTG Acc1 (i, Vietnam) CTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGTTGAGGTTG Acc624 (j, Celebes Is.) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGTTGAGGTTG Acc415 (i, India) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc417 (i, India) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc435 (i, Ceylon) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc712 (j, Central China) CTAAAACGGATCAGTAGCATACTTGCCGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc201 (j, Philippines) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc206 (j, Philippines) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc724 (i, South China) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc224 (j, Philippines) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc220 (j,Philippines) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG AccUp3 (j, Japan) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG AccUp1 (j, Japan) CTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTG Acc563 (j, Japan) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc709 (j, Central China) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc848 (j, Mountains of Taiwan) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc504 (j, Taiwan) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc757 (j, Hai-Nan-Tao) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc108 (i, Taiwan) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc130 (i, Taiwan) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc414 (i, India) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc710 (i, Central China) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc719 (i, Central China) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc729 (i, South China) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc761 (i, Hai-Nan-Tao) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG Acc420 (i, India) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTG AccUp4 (j, Japan) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACAAGGAAGGGGCTGAGGTTG Acc642 (j, Celebes Is.) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACAAGGAAGGGGCTGAGGTTG Acc708 (j, North China) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACAAGGAAGGGGCTGAGGTTG Acc421 (i, India) CTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACAAGGAAGGGGCTGAGGTTG ************* *** ******* ***** ***** *** ** ***** ******** Acc440 CCTCAAGAAAAAGGAAATAAGACAATTAAAAACCCGTTGCCTCAAGGTAAAACAAAGGAG Acc868 CCTCAAGAAAAAGGAAATAAGACAATTAAAAACCCGTTGCCTCAAGGTAAAACAAAGGAG Acc101 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc706 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc715 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc1 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc624 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc415 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc417 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc435 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc712 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc201 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc206 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc724 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc224 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc220 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG AccUp3 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG AccUp1 CCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAG Acc563 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc709 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc848 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc504 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc757 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc108 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc130 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc414 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc710 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc719 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc729 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc761 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG Acc420 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAG AccUp4 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGAAG Acc642 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGAAG Acc421 CCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGAAG ************ * ** *** **** ********** ******** ********* ** Fig. S2b. DNA sequence alignment of the Pikm2-TS LRR region in set 2 lines. In parentheses, indica (i) and japonica (j) origins are followed by geographic origin ofline. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2b(1/5)

7 Acc440 CCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc868 CCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc101 CCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc706 CCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc715 CCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc1 CCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc624 CCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc415 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc417 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc435 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc712 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc201 CCTGCAGAGAAAGGATCCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc206 CCTGCAGAGAAAGGATCCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc724 CCTGCAGAGAAAGGATCCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc224 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc220 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT AccUp3 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT AccUp1 CCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGT Acc563 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc709 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc848 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc504 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc757 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc108 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc130 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc414 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc710 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc719 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc729 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc761 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc420 CCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT AccUp4 CCCACAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc642 CCCACAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc708 CCCACAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT Acc421 CCCACAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGT ** ** ********* *** ************* ******* ******* ******** Acc440 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc868 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc101 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc706 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc715 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc1 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc624 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc415 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc417 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc435 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc712 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc201 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc206 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc724 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc224 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc220 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG AccUp3 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG AccUp1 GTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAG Acc563 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc709 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc848 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc504 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc757 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc108 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc130 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc414 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc710 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc719 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc729 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc761 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc420 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG AccUp4 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc642 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc708 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG Acc421 GTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAG ******************** ***** ****** *** ********** *********** Fig. S2b. DNA sequence alignment of the Pikm2-TS LRR region in set 2 rice lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2b (2/5)

8 Acc440 TTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc868 TTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc101 TTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc706 TTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc715 TTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc1 TTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc624 TTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc415 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc417 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc435 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc712 TTGACAGGACTAAGGAAGCTTGCCNTTTACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc201 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc206 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc724 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc224 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc220 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA AccUp3 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA AccUp1 TTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACA Acc563 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc709 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc848 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc504 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc757 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc108 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc130 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc414 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc710 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc719 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc729 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc761 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc420 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC AccUp4 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc642 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc708 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC Acc421 TTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACC ******** ************** * *********** **** *** ****** Acc440 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCATCTGCGGCCTGCAGACTCTGGCC Acc868 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCATCTGCGGCCTGCAGACTCTGGCC Acc101 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc706 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc715 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc1 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc624 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc415 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc417 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc435 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc712 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc201 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc206 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc724 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc224 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc220 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC AccUp3 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC AccUp1 TTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCC Acc563 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc709 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc848 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc504 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc757 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc108 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc130 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc414 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc710 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc719 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc729 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc761 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc420 TTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC AccUp4 TTCAAACAATTACAGTCCTCCATTGAATACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc642 TTCAAACAATTACAGTCCTCCATTGAATACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc708 TTCAAACAATTACAGTCCTCCATTGAATACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC Acc421 TTCAAACAATTACAGTCCTCCATTGAATACCTTGGCAGCTGTGGTCTGCAGACTCTGGCC ****** ****** ***** ***** ********** *** ** *************** Fig. S2b. DNA sequence alignment of the Pikm2-TS LRR region in set 2 lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2b (3/5)

9 Acc440 ATCAATGATGAGAATTCTAAATTTATCAACTCATCGCACCTGCACTACATGTCTGCACCT Acc868 ATCAATGATGAGAATTCTAAATTTATCAACTCATCGCACCTGCACTACATGTCTGCACCT Acc101 ATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACTACATGTCTGCACCT Acc706 ATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACTACATGTCTGCACCT Acc715 ATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACTACATGTCTGCACCT Acc1 ATCAATGATGAGAATTCTAAATTTATCAACTCACTGCACCTGCACTACATGTCTGCACCT Acc624 ATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACTACATGTCTGCACCT Acc415 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc417 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc435 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc712 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc201 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc206 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc724 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc224 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc220 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT AccUp3 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT AccUp1 ATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACAACATGTCTGCACCT Acc563 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc709 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc848 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc504 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc757 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc108 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc130 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc414 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc710 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc719 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc729 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc761 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc420 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT AccUp4 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc642 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc708 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT Acc421 ATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCGACATGCCCGCGCCT ****************** ************** * ***** * ** *** Acc440 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGCTACCTGTGTGGATC Acc868 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGCTACCTGTGTGGATC Acc101 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGCTACCTGTGTGGATC Acc706 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGCTACCTGTGTGGATC Acc715 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGCTACCTGTGTGGATC Acc1 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGCTACCTGTGTGGATC Acc624 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGCTACCTGTGTGGATC Acc415 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGGGTGGATC Acc417 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGGGTGGATC Acc435 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGGGTGGATC Acc712 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGGGTGGATC Acc201 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATC Acc206 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATC Acc724 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATC Acc224 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATC Acc220 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATC AccUp3 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATC AccUp1 CCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATC Acc563 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc709 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc848 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc504 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc757 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc108 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc130 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc414 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc710 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc719 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc729 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc761 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc420 CCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC AccUp4 CCAAGATATCTTATCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc642 CCAAGATATCTTATCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc708 CCAAGATATCTTATCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC Acc421 CCAAGATATCTTATCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATC *********** ** ************* ********* * ****** ******* Fig. S2b. DNA sequence alignment of the Pikm2-TS LRR region in set 2 rice lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2b (4/5)

10 Acc440 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc868 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc101 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc706 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc715 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc1 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc624 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc415 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc417 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc435 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc712 ACCAGCATTACTACTCTCAACAGGTTAACCATATCTATAACAGTTCTT Acc201 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc206 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc724 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc224 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc220 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT AccUp3 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT AccUp1 ACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTCTT Acc563 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc709 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc848 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc504 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc757 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc108 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc130 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc414 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc710 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc719 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc729 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc761 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc420 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT AccUp4 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc642 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc708 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT Acc421 ACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTCTT ******** ************* * *********** *********** Figure S2b. DNA sequence alignment of the Pikm2-TS LRR region in set 2 lines. Alleles classed into clades 1, 2, and 3 are depicted in green, blue, and red, respectively. Ashikawa et al. Supplementary figure S2b (5/5)


Download ppt "Acc414 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA--- Acc420 (i, India) TTGGACCTTGAAGATAATAAGGATATACAGGATTCTCATCTGCAGGGCATATGTGAA---"

Similar presentations


Ads by Google