Presentation is loading. Please wait.

Presentation is loading. Please wait.

Acc414 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc420 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc761 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA.

Similar presentations


Presentation on theme: "Acc414 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc420 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc761 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA."— Presentation transcript:

1 Acc414 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc420 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc761 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 K60_Pik-p ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc130 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc108 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc719 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc729 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc709 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc710 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc504 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc848 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc563 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc757 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Tsuyuake_Pik-m ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Kanto51_Pik ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Kusabue_Pik ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Nipponbare ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 AccUP ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 AccUP ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 Acc ATGGCCGTATACAGCGTCGCCACGGGGGCCTTGGCTCCCGTCCTA 45 ********* * **.***************** ***** *** Acc414 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc420 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc761 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 K60_Pik-p GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc130 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc108 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc719 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc729 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc709 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc710 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc504 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc848 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc563 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc757 GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Tsuyuake_Pik-m GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Kanto51_Pik GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Kusabue_Pik GTGAAGCTGGCCGCTTTGCTGGACGACGGGGAGTGCAATCTTCTGGAGGGGAGCCGGAGC 117 Acc201 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc206 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc1 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc101 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc718 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc724 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc715 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc706 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc624 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc440 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc868 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc220 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Nipponbare TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 AccUP3 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 AccUP1 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 Acc224 TCGAAGCTCTCCGCTTTGCTGGGCGACGAGCACTTGGATCTTGCGGAGAGGACCCGGAGC 105 ****** ************.*****.* * *.***** ****.*** ******* Fig. S1. Multiple alignment of the first-gene sequences of the 28 rice lines, cultivars showing Pik-family-specific blast resistance (Kusabue, Kanto 51, Tsuyuake, and K60) and the susceptible Nipponbare. Sequences grouped in clade 1 are black, and those in clade 2 are red. Ashikawa et al. Supplementary Fig. S1 (1/30)

2 Acc414 GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc420 GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc761 GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 K60_Pik-p GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc130 GACGCAGAGTTCATCAGATCCGAGCTGAAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc108 GACGCAGAGTTCATCAGATCCGAGCTGAAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc719 GACGCAGAGTTCATCAGATCCGAGCTGAAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc729 GACGCAGAGTTCATCAGATCCGAGCTGAAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc709 GACGCAGAGTTCATCAGATCCGAGCTGAAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc710 GACGCAGAGTTCATCAGATCCGAGCTGAAGGCCGTTCATTCTCTCCTCACCCCAAATATC 177 Acc504 GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTGCACTCTCTCCTCACCCCAAATATC 177 Acc848 GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTGCACTCTCTCCTCACCCCAAATATC 177 Acc563 GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTGCACTCTCTCCTCACCCCAAATATC 177 Acc757 GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTGCACTCTCTCCTCACCCCAAATATC 177 Tsuyuake_Pik-m GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTGCACTCTCTCCTCACCCCAAATATC 177 Kanto51_Pik GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTGCACTCTCTCCTCACCCCAAATATC 177 Kusabue_Pik GACGCAGAGTTCATCAGATCCGAGCTGGAGGCCGTGCACTCTCTCCTCACCCCAAATATC 177 Acc201 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc206 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc1 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc101 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc718 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc724 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc715 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc706 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc624 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc440 GACGCCATGTTCATCAGGTTCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc868 GACGCCATGTTCATCAGGTTCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc220 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Nipponbare GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 AccUP3 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 AccUP1 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 Acc224 GACGCCATGTTCATCAGGTCCCAGCTGGAGGCCGTGCACTCTCTCCTCCTCCCGAGGATT 165 *****..:*********.* * *****.******* ** *********. ***.*. ** Acc414 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc420 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc761 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 K60_Pik-p --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc130 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc108 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc719 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc729 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc709 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc710 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc504 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc848 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc563 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc757 --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Tsuyuake_Pik-m --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Kanto51_Pik --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Kusabue_Pik --TTGGGGAG-GATGGGGGATGA---CGATGCGGCGTGCAAGGATGGCTTGATTGCGGAG 231 Acc201 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc206 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc1 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc101 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc718 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc724 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc715 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc706 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc624 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc440 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc868 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc220 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Nipponbare AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 AccUP3 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 AccUP1 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 Acc224 AGTTGGGGAATGACGGGGGAGGAAGTCGATGCTTTGTGCAAGGATGAGTTGATGGCGGAG 225 *******. ** ****** ** ****** ***********. ***** ****** Ashikawa et al. Supplementary Fig. S1 (2/30)

3 Acc414 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc420 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc761 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 K60_Pik-p GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc130 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc108 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc719 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc729 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc709 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc710 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc504 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc848 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc563 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc757 GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Tsuyuake_Pik-m GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Kanto51_Pik GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Kusabue_Pik GTCCGGGAGCTGTCCTACGACCTGGATGATGCCGTCGACGACTTCTT------GGAGCTC 285 Acc201 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc206 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc1 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc101 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc718 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc724 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc715 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc706 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc624 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc440 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc868 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc220 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Nipponbare GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 AccUP3 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 AccUP1 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 Acc224 GTGCGTGAGCTGTCCTACGACATGGACGACGCCATCGACGAATTCTTCTTAGAGGAGCCC 285 ** ** ***************.**** ** ***.*******.***** ***** * Acc414 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc420 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc761 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 K60_Pik-p AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc130 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc108 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc719 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc729 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc709 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc710 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc504 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc848 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc563 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc757 AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Tsuyuake_Pik-m AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Kanto51_Pik AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Kusabue_Pik AATTTCGAGCAGCGAAGAAGCGCAAGCCCTTTCGGTGAGCTCAAGGCAAGAGTTGAGGAG 345 Acc201 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc206 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc1 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc101 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc718 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc724 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc715 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc706 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc624 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc440 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc868 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc220 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Nipponbare A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 AccUP3 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 AccUP1 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 Acc224 A-TGGCGGGCGGCGA-----CGGTGGCCCTTTCGATGAGCTCAAGACAAGAGTTGAGGA- 338 * * **.**.**** ** :.*********.**********.************* Ashikawa et al. Supplementary Fig. S1 (3/30)

4 Acc414 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc420 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc761 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 K60_Pik-p CATGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc130 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc108 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc719 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc729 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc709 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc710 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc504 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc848 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc563 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc757 CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Tsuyuake_Pik-m CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Kanto51_Pik CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Kusabue_Pik CGTGTCTCCAATCGCTTCTCTGAC TGGAAGCTACCGGCGGCG AG 389 Acc201 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc206 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc1 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc101 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc718 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc724 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc715 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc706 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc624 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc440 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc868 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc220 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Nipponbare --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 AccUP3 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 AccUP1 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 Acc224 --TGTCTCCAAGCGGTTCTCCGACAGCCGGCGGTGGAGGCCACCGGTGGAGCAACATCAA 396 ********* ** ***** *** ****.** ***** **.* *. Acc414 CCTTCC---GCCGTCGT--CGGTACACCGCCGA GCTGGCTTG--CCGCCAC 433 Acc420 CCTTCC---GCCGTCGT--CGGTACACCGCCGA GCTGGCTTG--CCGCCAC 433 Acc761 CCTTCC---GCCGTCGT--CGGTACACCGCCGA GCTGGCTTG--CCGCCAC 433 K60_Pik-p CCTTCC---GCCGTCGT--CGGTACACCGCCGA GCTGGCTTG--CCGCCAC 433 Acc130 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc108 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc719 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc729 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc709 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc710 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc504 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc848 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc563 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc757 CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Tsuyuake_Pik-m CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Kanto51_Pik CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Kusabue_Pik CCTTCC---GCCGTCGT--CGGTACACCGTCGA GCTGGCTTG--CCGCCAC 433 Acc201 CCATCCCTAACTGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc206 CCATCCCTAACTGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc1 CCATCCCTAACCGCCGCAACCGTAGACTCTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc101 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc718 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc724 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc715 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc706 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc624 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc440 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc868 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc220 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Nipponbare CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 AccUP3 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 AccUP1 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 Acc224 CCATCCCTAACCGCCGCAACCGTAGACTGTCCACCTCCTCACGCTCGCTTCGTCCACAAC 456 **:***.* * ** * *** ** * * *** **** **.*.** Ashikawa et al. Supplementary Fig. S1 (4/30)

5 Acc414 CAGATG CAGAGCTGGTGGGGATGGACAAAC---GTATGGAAGAGCTCACCAAA 483 Acc420 CAGATG CAGAGCTGGTGGGGATGGACAAAC---GTATGGAAGAGCTCACCAAA 483 Acc761 CAGATG CAGAGCTGGTGGGGATGGACAAAC---GTATGGAAGAGCTCACCAAA 483 K60_Pik-p CAGATG CAGAGCTGGTGGGGATGGACAAAC---GTATGGAAGAGCTCACCAAA 483 Acc130 CAGATG CAGGGCTGGTGGGGATGGACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc108 CAGATG CAGGGCTGGTGGGGATGGACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc719 CAGATG CAGGGCTGGTGGGGATGGACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc729 CAGATG CAGGGCTGGTGGGGATGGACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc709 CAGATG CAGGGCTGGTGGGGATGGACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc710 CAGATG CAGGGCTGGTGGGGATGGACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc504 CAGATG CAGGGCTGGTGGGGATGCACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc848 CAGATG CAGGGCTGGTGGGGATGCACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc563 CAGATG CAGGGCTGGTGGGGATGCACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc757 CAGATG CAGGGCTGGTGGGGATGCACAAAC---GTAAGGAAGAGCTCATCGAG 483 Tsuyuake_Pik-m CAGATG CAGGGCTGGTGGGGATGCACAAAC---GTAAGGAAGAGCTCATCGAG 483 Kanto51_Pik CAGATG CAGGGCTGGTGGGGATGCACAAAC---GTAAGGAAGAGCTCATCGAG 483 Kusabue_Pik CAGATG CAGGGCTGGTGGGGATGCACAAAC---GTAAGGAAGAGCTCATCGAG 483 Acc201 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc206 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc1 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516 Acc101 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc718 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc724 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc715 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc706 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc624 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACTACATGAGAAAGAGCTCATCAAA 516 Acc440 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516 Acc868 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516 Acc220 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516 Nipponbare ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516 AccUP3 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516 AccUP1 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516 Acc224 ATGATGGATGTGTCAGAGCTCGTGGAGATGGACAAACAACATGAGAAAGAGCTCATCAAA 516.:**** ***.*** ****.**** ******.*.:*.********* *.*. Acc414 TTGCTGGAACAAGG GAGCAATGATGCTTCACGATGGCGCAAGCGAAAACCG 534 Acc420 TTGCTGGAACAAGG GAGCAATGATGCTTCACGATGGCGCAAGCGAAAACCG 534 Acc761 TTGCTGGAACAAGG GAGCAATGATGCTTCACGATGGCGCAAGCGAAAACCG 534 K60_Pik-p TTGCTGGAACAAGG GAGCAATGATGCTTCACGATGGCGCAAGCGAAAACCG 534 Acc130 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc108 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc719 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc729 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc709 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc710 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc504 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc848 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc563 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc757 TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Tsuyuake_Pik-m TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Kanto51_Pik TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Kusabue_Pik TTGCTGGAACAAGG GAGCAGTGATGCTTCACGATGGCGCAAGCGAAAACCT 534 Acc201 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc206 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc1 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc101 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc718 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc724 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc715 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc706 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc624 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc440 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc868 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc220 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Nipponbare TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 AccUP3 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 AccUP1 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 Acc224 TTGCTGGAACAAGGTGCGGACACAAGCATATATGCTTCCCGGTGGCGCA TCG 568 **************.**** : *******.**.******* * Ashikawa et al. Supplementary Fig. S1 (5/30)

6 Acc414 CATTTCCCGCTCAGAAAAAC---AGGGCTAAAG---CAAAAAATCGTGATCAAGGTTGCC 588 Acc420 CATTTCCCGCTCAGAAAAAC---AGGGCTAAAG---CAAAAAATCGTGATCAAGGTTGCC 588 Acc761 CATTTCCCGCTCAGAAAAAC---AGGGCTAAAG---CAAAAAATCGTGATCAAGGTTGCC 588 K60_Pik-p CATTTCCCGCTCAGAAAAAC---AGGGCTAAAGGTACGAAAAATCGTGATCAAGGTTGCC 591 Acc130 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc108 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc719 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc729 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc709 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc710 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc504 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc848 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc563 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc757 CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Tsuyuake_Pik-m CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Kanto51_Pik CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Kusabue_Pik CATGTCCCCCTCAGGATAATGGGAGGGGAAATG---CAAAAAATCGTGTTCAAGATTCCC 591 Acc201 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc206 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc1 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc101 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc718 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc724 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc715 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc706 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc624 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc440 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc868 CAACACCATGGCATGATAA GGAG---CAAAGTATTGTGGTCAAGGT-GCC 614 Acc220 CAACACCATGGCATGATAA GGAG---CAAAGTACTGTGGTCAAGGT-GCC 614 Nipponbare CAACACCATGGCATGATAA GGAG---CAAAGTACTGTGGTCAAGGT-GCC 614 AccUP3 CAACACCATGGCATGATAA GGAG---CAAAGTACTGTGGTCAAGGT-GCC 614 AccUP1 CAACACCATGGCATGATAA GGAG---CAAAGTACTGTGGTCAAGGT-GCC 614 Acc224 CAACACCATGGCATGATAA GGAG---CAAAGTACTGTGGTCAAGGT-GCC 614 **: :**. **.*:**..:* *.**.:* *** *****.* ** Acc414 ATGGAGGGCAATAATTGCCGTTCAAAAGCAATGGC-----TTTAGTTAAGA-GCACTGGA 642 Acc420 ATGGAGGGCAATAATTGCCGTTCAAAAGCAATGGC-----TTTAGTTAAGA-GCACTGGA 642 Acc761 ATGGAGGGCAATAATTGCCGTTCAAAAGCAATGGC-----TTTAGTTAAGA-GCACTGGA 642 K60_Pik-p ATGGAGGGCAATAATTGCCGTTCAAAAGCAATGGC-----TTTAGTTGCGA-GCACTGGA 645 Acc130 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GCACGGTT 645 Acc108 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GCACGGTT 645 Acc719 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GCACGGTT 645 Acc729 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GCACGGTT 645 Acc709 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GCACGGTT 645 Acc710 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GCACGGTT 645 Acc504 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GTACGGTT 645 Acc848 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GTACGGTT 645 Acc563 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GTACGGTT 645 Acc757 ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GTACGGTT 645 Tsuyuake_Pik-m ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GTACGGTT 645 Kanto51_Pik ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GTACGGTT 645 Kusabue_Pik ATGGTGGACGATAAGAGCCGTACAAAAGCAATGTC-----ATTGGTTGCAA-GTACGGTT 645 Acc201 --GGAAAA-AAGAAGGGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc206 --GGAAAA-AAGAAGGGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc1 --GGAAAA-AAGAAGGGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc101 --GGAAAA-AAGAAGTGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc718 --GGAAAA-AAGAAGGGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc724 --GGAAAA-AAGAAGTGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc715 --GGAAAA-AAGAAGTGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc706 --GGAAAA-AAGAAGTGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc624 --GGAAAA-AAGAAGTGACG-ACATGAACGAT GATGCATTGCACTGGG 658 Acc440 --GGGAAA-AAGAAGGGACG-ACATGAACGATGACGACCAACCCAGTGCATTGCACTGGG 670 Acc868 --GGGAAA-AAGAAGGGACG-ACATGAACGATGACGACCAACCCAGTGCATTGCACTGGG 670 Acc220 --GGAAAG-AGAGTGGGGCT-TCCCGGACAAT------CGGAACAGTCCATTTATATGGG 664 Nipponbare --GGAAAG-AGAGTGGGGCT-TCCCGGACAAT------CGGAACAGTCCATTTATATGGG 664 AccUP3 --GGAAAG-AGAGTGGGGCT-TCCCGGACAAT------CGGAACAGTCCATTTATATGGG 664 AccUP1 --GGAAAG-AGAGTGGGGCT-TCCCGGACAAT------CGGAACAGTCCATTTATATGGG 664 Acc224 --GGAAAG-AGAGTGGGGCT-TCCCGGACAAT------CGGAACAGTCCATTTATATGGG 664 **......: * * :*....*.**. *..: :. * Ashikawa et al. Supplementary Fig. S1 (6/30)

7 Acc414 GGAGTGTACTC--GGTTGC GCTCGCAGGTGATCTA---AGAGAC Acc420 GGAGTGTACTC--GGTTGC GCTCGCAGGTGATCTA---AGAGAC Acc761 GGAGTGTACTC--GGTTGC GCTCGCAGGTGATCTA---AGAGAC K60_Pik-p GGAGTGGACTC--GGTTGC GCTCGTAGGTGATCTA---AGAGAC Acc130 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc108 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc719 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc729 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc709 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc710 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc504 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc848 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc563 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc757 GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Tsuyuake_Pik-m GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Kanto51_Pik GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Kusabue_Pik GGAGTGCACTC--GGTTGC AATCGCCGGTGACCTA---AGAGAC Acc201 CG-GTGAGTTT---GTTGCATGGAGTGCCCTCGGGTGGTACGTTTGGAGATTGT----AG 710 Acc206 CG-GTGAGTTT---GTTGCATGGAGTGCCCTCGGGTGGTACGTTTGGAGATTGT----AG 710 Acc1 CG-GTGAGTTT---GTTGCATGGAGTGCCCTCGGGTGGTACGTCTGGAGATTGT----AG 710 Acc101 CG-GTGAGTTT---GTCGCATGGAGTGCCCTCGGGTGGTACGTCTGGAGATTGT----AG 710 Acc718 CG-GTGAGTTT---GTTGCATGGAGTGCCCTCGGGTGGTACGTCTGGAGATTGT----AG 710 Acc724 CG-GTGAGTTT---GTCGCATGGAGTGCCCTCGGGTGGTACGTCTGGAGATTGT----AG 710 Acc715 CG-GTGAGTTT---GTCGCATGGAGTGCCCTCGGGTGGTACGTCTGGAGATTGT----AG 710 Acc706 CG-GTGAGTTT---GTCGCATGGAGTGCCCTCGGGTGGTACGTCTGGAGATTGT----AG 710 Acc624 CG-GTGAGTTT---GTCGCATGGAGTGCCCTCGGGTGGTACGTCTGGAGATTGT----AG 710 Acc440 CG-GTGAGTAGTAGGTTGCATGGAGTGCCCTCGGGTGGTGCGTCTGGAGATTGT----AG 725 Acc868 CG-GTGAGTAGTAGGTTGCATGGAGTGCCCTCGGGTGGTGCGTCTGGAGATTGT----AG 725 Acc220 CGAGTGATTCGT---TTGAACG-ATTGCGTTCGGGAAGTTTGTGTGGAGAT Nipponbare CGAGTGATTCGT---TTGAACG-ATTGCGTTCGGGAAGTTTGTGTGGAGAT AccUP3 CGAGTGATTCGT---TTGAACG-ATTGCGTTCGGGAAGTTTGTGTGGAGAT AccUP1 CGAGTGATTCGT---TTGAACG-ATTGCGTTCGGGAAGTTTGTGTGGAGAT Acc224 CGAGTGATTCGT---TTGAACG-ATTGCGTTCGGGAAGTTTGTGTGGAGAT * *** * *... **:....**** Acc414 AAGATAGTGGAGATAGTGGTGGTCGGTTATGGCATTGACCCCATCAAGCTGATCTCCGCG 741 Acc420 AAGATAGTGGAGATAGTGGTGGTCGGTTATGGCATTGACCCCATCAAGCTGATCTCCGCG 741 Acc761 AAGATAGTGGAGATAGTGGTGGTCGGTTATGGCATTGACCCCATCAAGCTGATCTCCGCG 741 K60_Pik-p AAGAT AGAGGTGGTCGGTTATGGCATTGACCCCATCAAGCTGATCTCCGCG 735 Acc130 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc108 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc719 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc729 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc709 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc710 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc504 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc848 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc563 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc757 GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Tsuyuake_Pik-m CAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Kanto51_Pik GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Kusabue_Pik GAGGT TGTGGTGGTCGGTGATGGCATTGACTCCATCAATCTGGTCTCTGCG 735 Acc201 TAGGT TGCAGTTGAATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc206 TAGGT TGCAGTTGAATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc1 TAGGT TGCAGTTGAATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc101 TAGGT TGCAGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc718 TAGGT TGCAGTTGCATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc724 TAGGT TGCAGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc715 TAGGT TGCAGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc706 TAGGT TGCAGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc624 TAGGT TGCAGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc440 TAGGT TGCAGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 777 Acc868 TAGGT TGCAGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 777 Acc220 -ACGT TGCGGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Nipponbare -ACGT TGCGGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 AccUP3 -ACGT TGCGGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 AccUP1 -ACGT TGCGGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 Acc224 -ACGT TGCGGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACC 762 *.* * ** : *** *:***..** *. *** ** * **.* Ashikawa et al. Supplementary Fig. S1 (7/30)

8 Acc414 CTCCGGAAGAAGGTGGGCCATGCGGAGTTGCTGCAGGTCA--GCCAAGCAAATAAAGATG 799 Acc420 CTCCGGAAGAAGGTGGGCCATGCGGAGTTGCTGCAGGTCA--GCCAAGCAAATAAAGATG 799 Acc761 CTCCGGAAGAAGGTGGGCCATGCGGAGTTGCTGCAGGTCA--GCCAAGCAAATAAAGATG 799 K60_Pik-p CTCCGGAAGAAGGTGGGCGATGCGGAGTTGCTGCAGGTCA--GCCAAGCAAATAAAGATG 793 Acc130 CTCCGGAAGAAGGTGGACCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc108 CTCCGGAAGAAGGTGGACCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc719 CTCCGGAAGAAGGTGGACCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc729 CTCCGGAAGAAGGTGGACCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc709 CTCCGGAAGAAGGTGGACCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc710 CTCCGGAAGAAGGTGGACCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc504 CTCCGGAAGAAGGTGGGCCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc848 CTCCGGAAGAAGGTGGGCCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc563 CTCCGGAAGAAGGTGGGCCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Acc757 CTCCGGAAGAAGGTGGGCCCTGCGATGTTTCTGGAGGTCA--GCCAAGCAAAGGAAGATG 793 Tsuyuake_Pik-m CTCCGGAAGAAGGTGGGCCCTGCGATGTTTCTGGAGGTCA--GCCAAGTAAAGGAAGATG 793 Kanto51_Pik CTCCGGAAGAAGGTGGGCCATGCGGAGTTGCTGCAGGTCA--GCCAAGTAAAGGAAGATG 793 Kusabue_Pik CTCCGGAAGAAGGTGGGCCATGCGGAGTTGCTGCAGGTCA--GCCAAGTAAAGGAAGATG 793 Acc201 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc206 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc1 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc101 CTCCGGAATAAGGTGGGCCACGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc718 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc724 CTCCGGAATAAGGTGGGCCACGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc715 CTCCGGAATAAGGTGGGCCACGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc706 CTCCGGAATAAGGTGGGCCACGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc624 CTCCGGAATAAGGTGGGCCACGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc440 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 835 Acc868 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 835 Acc220 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Nipponbare CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 AccUP3 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 AccUP1 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 Acc224 CTCCGGAATAAGGTGGGCCGCGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGG--G 820 ******** *******.* ** :*** ** *****. *. ***.**.*.* * Acc414 TGAAGGAGACGACGCCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACAAGGTCA 859 Acc420 TGAAGGAGACGACGCCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACAAGGTCA 859 Acc761 TGAAGGAGACGACGCCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACAAGGTCA 859 K60_Pik-p TGAAGGAGACGACGCCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACAAGGTCA 853 Acc130 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc108 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc719 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc729 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc709 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc710 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc504 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc848 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc563 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc757 TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Tsuyuake_Pik-m TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Kanto51_Pik TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Kusabue_Pik TGAAGGAGATAACGGCGATGCTTGCGCCGGTGAAATCCATATGTGAATTTCACGAGGTCA 853 Acc201 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc206 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc1 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc101 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc718 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc724 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc715 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc706 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc624 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc440 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 874 Acc868 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 874 Acc220 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Nipponbare TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 AccUP3 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 AccUP1 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 Acc224 TAGAGGAGGCGA---CGAAGCCT TGTGAATTTCACGAGGTCA 859 *..*****..* ***:** * ************.****** Ashikawa et al. Supplementary Fig. S1 (8/30)

9 Acc414 AAACAGTTTGCATCCTTGGATTGCCAGGTGGAGGCAAAACAACGGTTGCCAGAGAATTAT 919 Acc420 AAACAGTTTGCATCCTTGGATTGCCAGGTGGAGGCAAAACAACGGTTGCCAGAGAATTAT 919 Acc761 AAACAGTTTGCATCCTTGGATTGCCAGGTGGAGGCAAAACAACGGTTGCCAGAGAATTAT 919 K60_Pik-p AAACAGTTTGCATCCTTGGATTGCCAGGTGGAGGCAAAACAACGGTTGCCAGAGAATTAT 913 Acc130 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc108 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc719 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc729 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc709 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc710 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc504 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc848 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc563 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc757 AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Tsuyuake_Pik-m AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Kanto51_Pik AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Kusabue_Pik AAACAATTTGCATCCTTGGATTGCCAGGGGGAGGCAAAACAACGATTGCCCGAGTACTAT 913 Acc201 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc206 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc1 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc101 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc718 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc724 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc715 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc706 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc624 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc440 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 934 Acc868 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 934 Acc220 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Nipponbare AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 AccUP3 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 AccUP1 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 Acc224 AAACAATATGCATCCTTGGATTGCCTGGCGCAGGCAAAACAACTCTTGCAAAACTGTTGT 919 *****.*:*****************:** * ************ ****...* :. *.* Acc414 A------TGACGCCTTGG--GAAC-GCACTTCCCATGCCGGGTTTTCGTGTCAGTCTCTC 970 Acc420 A------TGACGCCTTGG--GAAC-GCACTTCCCATGCCGGGTTTTCGTGTCAGTCTCTC 970 Acc761 A------TGACGCCTTGG--GAAC-GCACTTCCCATGCCGGGTTTTCGTGTCAGTCTCTC 970 K60_Pik-p A------TGACGCCTTGG--GAAC-GCACTTCCCATGCCGGGTTTTCGTGTCAGTCTCTC 964 Acc130 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc108 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc719 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc729 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc709 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc710 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc504 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc848 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc563 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc757 A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Tsuyuake_Pik-m A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Kanto51_Pik A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Kusabue_Pik A------TCATGCATTGG--GAAC-GCAGTTCCAATGCCGGGTTTTCGCATCAATCTCTC 964 Acc201 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc206 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc1 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc101 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc718 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc724 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc715 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc706 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc624 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc440 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 994 Acc868 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 994 Acc220 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Nipponbare ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 AccUP3 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 AccUP1 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 Acc224 ACTCCCATCACTCAACGACAGAGCAGCAATTCCAACACCGGGCTTTCGTGTCACTCTCTC 979 * * * *.: *. **.* *** ****.*.***** *****.*** ****** Ashikawa et al. Supplementary Fig. S1 (9/30)

10 Acc414 CAAGTTCTAGTCCCAGTCCCAATCTCACAAAGACTCTTGCAGACATTTTCGCTCAAGCAC 1030 Acc420 CAAGTTCTAGTCCCAGTCCCAATCTCACAAAGACTCTTGCAGACATTTTCGCTCAAGCAC 1030 Acc761 CAAGTTCTAGTCCCAGTCCCAATCTCACAAAGACTCTTGCAGACATTTTCGCTCAAGCAC 1030 K60_Pik-p CAAGTTCTAGTCCCAGTCCCAATCTCACAAAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc130 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc108 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc719 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc729 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc709 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc710 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc504 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc848 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc563 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc757 CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Tsuyuake_Pik-m CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Kanto51_Pik CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Kusabue_Pik CAAGTTCCAGCCCCAGTCCCAATCTAACAGAGACTCTTGCAGACATTTTCGCTCAAGCAC 1024 Acc201 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc206 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc1 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc101 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc718 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc724 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc715 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc706 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc624 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc440 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1036 Acc868 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1036 Acc220 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Nipponbare CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 AccUP3 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 AccUP1 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 Acc224 CGGGTGC CAATCTCACCGACACTCTTACTGATATTTT------ATTGC 1021 *..** * ******.**..* ******.*:** ***** *.* Acc414 AACTAGGAGTAACCGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1090 Acc420 AACTAGGAGTAACCGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1090 Acc761 AACTAGGAGTAACCGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1090 K60_Pik-p AACTAGGAGTAACCGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc130 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc108 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc719 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc729 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc709 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc710 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc504 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc848 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc563 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc757 AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Tsuyuake_Pik-m AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Kanto51_Pik AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Kusabue_Pik AACTAGGAGTAACTGATACACTTAGCACACCATATGGTGGGAGTGGGACCGGGAGAGCTC 1084 Acc201 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc206 AAGTAGGAGCATATAATGATGATGCAACCCCATATTGTGG------GACCGGAACACCGC 1075 Acc1 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc101 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc718 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc724 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc715 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc706 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc624 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc440 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1090 Acc868 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1090 Acc220 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Nipponbare AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 AccUP3 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 AccUP1 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 Acc224 AAGTAGGAGCATATAATGATGATGCAACACCATATTGTGG------GACCGGAACACCGC 1075 ** ****** *:..**..: :*..**.****** **** ******.* * * * Ashikawa et al. Supplementary Fig. S1 (10/30)

11 Acc414 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1150 Acc420 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1150 Acc761 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1150 K60_Pik-p TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc130 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc108 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc719 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc729 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc709 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc710 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc504 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc848 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc563 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc757 TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Tsuyuake_Pik-m TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Kanto51_Pik TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Kusabue_Pik TTCAACAACATCTCATCGACAACATATCAGCTTTCCTCCTCAACAAAAAGTATCTCATTG 1144 Acc201 ACCAACAGTATCTCATTGACAATATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc206 ACCAACAGTATCTCATTGACAATATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc1 ACCAACAGTATCTCATTGACAACATGTCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc101 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc718 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc724 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc715 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc706 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc624 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc440 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1150 Acc868 ACCAACAGTATCTCATTGACAACATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1150 Acc220 ACCAACAGTATCTCATTGACAATATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Nipponbare ACCAACAGTATCTCATTGACAATATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 AccUP3 ACCAACAGTATCTCATTGACAATATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 AccUP1 ACCAACAGTATCTCATTGACAATATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 Acc224 ACCAACAGTATCTCATTGACAATATATCAGCTTATCTCATTGGCAAAAAGTATCTTATTA 1135 : *****. ******* ***** **.*******: ***.*..************ ***. Acc414 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1210 Acc420 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1210 Acc761 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1210 K60_Pik-p TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc130 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc108 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc719 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc729 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc709 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc710 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc504 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc848 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc563 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc757 TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Tsuyuake_Pik-m TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Kanto51_Pik TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Kusabue_Pik TAATCGATGACATTTGGCATTGGGAAGAATGGGAAGTCATCAGAAAGTCCATTCCCAAGA 1204 Acc201 TAATTGATGACGTTTGGCACTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc206 TAATTGATGACGTTTGGCACTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc1 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc101 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc718 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc724 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc715 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc706 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc624 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc440 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1210 Acc868 TAATTGATGACGTTTGGCGCTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1210 Acc220 TAATTGATGACGTTTGGCACTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Nipponbare TAATTGATGACGTTTGGCACTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 AccUP3 TAATTGATGACGTTTGGCACTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 AccUP1 TAATTGATGACGTTTGGCACTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 Acc224 TAATTGATGACGTTTGGCACTGGGAAGAGTGGGAAGTCATCAGAAAGTCCATTCCAAAGA 1195 **** ******.******. ********.**************************.**** Ashikawa et al. Supplementary Fig. S1 (11/30)

12 Acc414 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1270 Acc420 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1270 Acc761 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1270 K60_Pik-p ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc130 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc108 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc719 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc729 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc709 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc710 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc504 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc848 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc563 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc757 ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Tsuyuake_Pik-m ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Kanto51_Pik ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Kusabue_Pik ATGATCTGGGTGGTAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGCC 1264 Acc201 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc206 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc1 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc101 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc718 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc724 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc715 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc706 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc624 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc440 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1270 Acc868 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1270 Acc220 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Nipponbare ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 AccUP3 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 AccUP1 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 Acc224 ATGATCTGGGTAGCAGAATAATCATGACTACTCGTCTTAATTCAATAGCTGAGAAGTGTC 1255 ***********.* ******************************************** * Acc414 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1330 Acc420 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1330 Acc761 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1330 K60_Pik-p ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc130 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc108 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc719 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc729 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc709 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc710 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc504 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc848 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc563 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc757 ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Tsuyuake_Pik-m ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Kanto51_Pik ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Kusabue_Pik ACACTGATGACAATGATGTTTTTGTCTACGAAGTTGGGGATCTAGATAATAATGATGCTT 1324 Acc201 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc206 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc1 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc101 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc718 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc724 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc715 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc706 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc624 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc440 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1330 Acc868 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1330 Acc220 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Nipponbare GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 AccUP3 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 AccUP1 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315 Acc224 GCAATGATGACATGGATGCGTTTGTTTATGAAACTGAGGCTCTGGATTATGTGGATGCTT 1315.**.********: **** ***** ** ***. **.**.***.***:**.: ******* Ashikawa et al. Supplementary Fig. S1 (12/30)

13 Acc414 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1390 Acc420 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1390 Acc761 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1390 K60_Pik-p TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc130 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc108 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc719 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc729 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc709 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc710 TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc504 GGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc848 GGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc563 GGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc757 GGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Tsuyuake_Pik-m GGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Kanto51_Pik TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Kusabue_Pik TGTCGTTGTCTTGGGGGATAGCAACAAAGTCTGGGGCAGGCAACAGGATCGGAACTGGAG 1384 Acc201 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc206 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc1 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc101 GGCTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc718 GGCTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc724 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc715 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc706 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc624 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc440 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc868 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc220 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Nipponbare GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT AccUP3 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT AccUP1 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT Acc224 GGTTGTTGTGTGACAAGGTAGCAAGAAAGTCTGTCACATGTATGAACAT * ***** *...*.****** ********.** * *: *. ** Acc414 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1450 Acc420 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1450 Acc761 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1450 K60_Pik-p AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc130 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc108 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc719 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc729 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc709 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc710 AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc504 AGGATAATTCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc848 AGGATAATTCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc563 AGGATAATTCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc757 AGGATAATTCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Tsuyuake_Pik-m AGGATAATTCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Kanto51_Pik AGGATAATCCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Kusabue_Pik AGGATAATTCATGCTATGATATTGTGAACATGTGTTATGGTATGCCTTTAGCACTTATTT 1444 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc1 ----TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACGTGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACGTGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1435 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1435 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Nipponbare ----TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 AccUP3 ----TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 AccUP1 ----TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 Acc TAATCCATGCTATGATATCGTGGACATGTGCTATGGTATGCCGTTAGCACTAATTC 1420 **** ************* ***.**.**** *********** ********:*** Ashikawa et al. Supplementary Fig. S1 (13/30)

14 Acc414 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1510 Acc420 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1510 Acc761 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1510 K60_Pik-p GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc130 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc108 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc719 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc729 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc709 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc710 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc504 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc848 GGCTGTCGTCAGCACTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc563 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc757 GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Tsuyuake_Pik-m GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Kanto51_Pik GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTACGTGGTGCTGAAGTGAAAAAAT 1504 Kusabue_Pik GGCTGTCGTCAGCATTGGTTGGAGAGATAGAAGAATTAGGTGGTGCTGAAGTGAAAAAAT 1504 Acc201 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc206 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc1 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc101 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc718 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc724 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc715 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc706 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc624 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc440 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1495 Acc868 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1495 Acc220 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Nipponbare GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 AccUP3 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 AccUP1 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 Acc224 GTGTGTCGTCAGCATTGGCAGAAGAGATACAAGCTTTAGACAGTGATGAACGGCAAATAT 1480 * *********** *** :*.******* ***.:***..***.**** *.***:** Acc414 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1570 Acc420 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1570 Acc761 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1570 K60_Pik-p GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc130 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc108 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc719 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc729 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc709 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc710 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc504 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc848 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc563 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc757 GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Tsuyuake_Pik-m GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Kanto51_Pik GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Kusabue_Pik GTAGGGATTTGAGACACATAGAGGATGGTATTTTGGACATCCCATCCTTACAACCATTGG 1564 Acc201 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc206 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc1 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc101 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc718 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc724 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc715 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc706 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc624 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc440 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGCAGCCATTGG 1555 Acc868 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1555 Acc220 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Nipponbare GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 AccUP3 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 AccUP1 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 Acc224 GGAGGGCTCTGAGACGGGTAGAGGATGGTATTTTGGACATCCCATCCTTGAAGCCATTGG 1540 * ****.* ******..*******************************..*.******* Ashikawa et al. Supplementary Fig. S1 (14/30)

15 Acc414 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1630 Acc420 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1630 Acc761 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1630 K60_Pik-p CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc130 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc108 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc719 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc729 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc709 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc710 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc504 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc848 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc563 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc757 CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Tsuyuake_Pik-m CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Kanto51_Pik CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Kusabue_Pik CGGAGAGTTTATGCCTTGGTTATAACCATCTTCCTCTTTATCTGAGGACTTTGTTGTTGT 1624 Acc201 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc206 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc1 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc101 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc718 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc724 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc715 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc706 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc624 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc440 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1615 Acc868 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1615 Acc220 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Nipponbare CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 AccUP3 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 AccUP1 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 Acc224 CAGAGAGTTTATGCCTTGGTTACGACCATCTTCCTCTCTATCTGAGGACTTTGTTGTTAT 1600 *.********************.************* ********************.* Acc414 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1684 Acc420 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1684 Acc761 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1684 K60_Pik-p ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc130 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc108 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc719 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc729 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc709 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc710 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc504 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc848 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc563 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc757 ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Tsuyuake_Pik-m ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Kanto51_Pik ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Kusabue_Pik ACTGTAGTGCATACCATTGGTCTAACAG---AATCG---AAAGGGGTCGTCTGGTCAGGA 1678 Acc201 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc206 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc1 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc101 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc718 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc724 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc715 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc706 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc624 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc440 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1675 Acc868 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1675 Acc220 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Nipponbare GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 AccUP3 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 AccUP1 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA 1660 Acc224 GTTGTAGTGTGTACCATTGGCTTGATGGTGGGATTGTTCAAAGGGGCCGTTTGGTCACAA *******.********* *.*.*.** * ******* *** ******.* Ashikawa et al. Supplementary Fig. S1 (15/30)

16 Acc414 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1744 Acc420 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1744 Acc761 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1744 K60_Pik-p GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc130 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc108 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc719 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc729 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc709 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc710 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc504 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc848 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc563 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc757 GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Tsuyuake_Pik-m GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Kanto51_Pik GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Kusabue_Pik GGTGGATTGCGGAAGGATTTGTGTCGGAAGAGAAAGAAGCAGAAGGTTACTTTGGCGAGC 1738 Acc201 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc206 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc1 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc101 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc718 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc724 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc715 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc706 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc624 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc440 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1735 Acc868 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1735 Acc220 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Nipponbare GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 AccUP3 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 AccUP1 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 Acc224 GGTGGATTGCTGAAGGATTTGTTTCAGAAGAGAAAGCAGCAGAAGGTTACTTTGATGAGC 1720 ********** *********** **.**********.*****************. **** Acc414 TTATTGACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1804 Acc420 TTATTGACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1804 Acc761 TTATTGACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1804 K60_Pik-p TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc130 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc108 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc719 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc729 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc709 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc710 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc504 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc848 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc563 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc757 TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Tsuyuake_Pik-m TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Kanto51_Pik TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Kusabue_Pik TTATTAACAGAGGATGGATTACGCAGCACGGAGACAACAACAGTTATAATTACTATGAGA 1798 Acc201 TTGTCGGCAGAGGATGGATGA---AGCATAGAGG GTTG-AACGAGTATGAGA 1768 Acc206 TTGTCGGCAGAGGATGGATGA---AGCATAGAGG GTTG-AACGAGTATGAGA 1768 Acc1 TTGTCGGCAGAGGATGGATGA---AGCATAGAGA GTTG-AACGAGTATGAGA 1768 Acc101 TTGTCGGCAGAGGATGGATTA---AGCATAGAGA GTGG-AACGAGTATGAGA 1768 Acc718 TTGTCGGCAGAGGATGGATTA---AGCATAGAGA GTGG-AACGAGTATGAGA 1768 Acc724 TTGTCGGCAGAGGATGGATGA---AGCATAGAGA GTTG-AACGAGTATGAGA 1768 Acc715 TTGTCGGCAGAGGATGGATGA---AGCATAGAGA GTTG-AACGAGTATGAGA 1768 Acc706 TTGTCGGCAGAGGATGGATGA---AGCATAGAGA GTTG-AACGAGTATGAGA 1768 Acc624 TTGTCGGCAGAGGATGGATGA---AGCATAGAGA GTTG-AACGAGTATGAGA 1768 Acc440 TTGTCGGCAGAGGATGGATGA---AGCATAGAGA GTTG-AACGAGTATGAGA 1783 Acc868 TTGTCGGCAGAGGATGGATGA---AGCATAGAGA GTTG-AACGAGTATGAGA 1783 Acc220 TTGTCGGCAGAGGATGGATGA---AGCATAGAGG GTTG-AACGAGTATGAGA 1768 Nipponbare TTGTCGGCAGAGGATGGATGA---AGCATAGAGG GTTG-AACGAGTATGAGA 1768 AccUP3 TTGTCGGCAGAGGATGGATGA---AGCATAGAGG GTTG-AACGAGTATGAGA 1768 AccUP1 TTGTCGGCAGAGGATGGATGA---AGCATAGAGG GTTG-AACGAGTATGAGA 1768 Acc224 TTGTCGGCAGAGGATGGATGA---AGCATAGAGG GTTG-AACGAGTATGAGA 1768 **.*..************ * ****.***. **. ** * ******* Ashikawa et al. Supplementary Fig. S1 (16/30)

17 Acc414 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1864 Acc420 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1864 Acc761 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1864 K60_Pik-p TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc130 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc108 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc719 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc729 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc709 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc710 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc504 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc848 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc563 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc757 TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Tsuyuake_Pik-m TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Kanto51_Pik TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Kusabue_Pik TCCACCCCGTGATGCTGGCCTTCCTGAGATGCAAGTCCAAGGAGTACAATTTTTTAACAT 1858 Acc201 TCCACCCTATGATGCTGGCCATCCTTAGATACAAATCGAAGGAGTACAATTTTGTAACTT 1828 Acc206 TCCACCCTATGATGCTGGCCATCCTTAGATACAAATCGAAGGAGTACAATTTTGTAACTT 1828 Acc1 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTTGTAACTT 1828 Acc101 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTTGTAACTT 1828 Acc718 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTTGTAACTT 1828 Acc724 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTCGTAACTT 1828 Acc715 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTCGTAACTT 1828 Acc706 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTCGTAACTT 1828 Acc624 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTCGTAACTT 1828 Acc440 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTTGTAACTT 1843 Acc868 TCCACCCTATGATGCTGGCCATCCTTAGATACAAGTCGAAGGAGTACAATTTTGTAACTT 1843 Acc220 TCCACCCTATGATGCTGGCCATCCTTAGATACAAATCGAAGGAGTACAATTTTGTAACTT 1828 Nipponbare TCCACCCTATGATGCTGGCCATCCTTAGATACAAATCGAAGGAGTACAATTTTGTAACTT 1828 AccUP3 TCCACCCTATGATGCTGGCCATCCTTAGATACAAATCGAAGGAGTACAATTTTGTAACTT 1828 AccUP1 TCCACCCTATGATGCTGGCCATCCTTAGATACAAATCGAAGGAGTACAATTTTGTAACTT 1828 Acc224 TCCACCCTATGATGCTGGCCATCCTTAGATACAAATCGAAGGAGTACAATTTTGTAACTT 1828 *******.***********:**** ****.***.** ************** ****:* Acc414 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1912 Acc420 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1912 Acc761 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1912 K60_Pik-p GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc130 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc108 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc719 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc729 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc709 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc710 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc504 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc848 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc563 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc757 GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Tsuyuake_Pik-m GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Kanto51_Pik GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Kusabue_Pik GCTTGGGTCTGGGATCTGATACTAGTACTAGTGCATC CTCCCCAAGGT 1906 Acc201 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc206 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc1 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc101 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc718 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc724 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc715 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc706 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc624 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc440 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1903 Acc868 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1903 Acc220 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Nipponbare GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 AccUP3 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 AccUP1 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 Acc224 GTTTGGGTACGGGATCTGATACTTGTACTAGTGCATCTCTATCCTACTCCTCTCCAACAA 1888 * ******. *************:************* *** ****.: Ashikawa et al. Supplementary Fig. S1 (17/30)

18 Acc414 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1969 Acc420 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1969 Acc761 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1969 K60_Pik-p TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc130 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc108 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc719 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc729 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc709 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc710 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc504 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc848 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc563 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc757 TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Tsuyuake_Pik-m TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Kanto51_Pik TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Kusabue_Pik TG---ATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGCATGA 1963 Acc201 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc206 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc1 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc101 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc718 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc724 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc715 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc706 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc624 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc440 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc868 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc220 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Nipponbare TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG AccUP3 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG AccUP1 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG Acc224 TGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG ** *********** * ******..******* ***.**.*.***** ***** Acc414 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGATCCAAGG 2029 Acc420 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGATCCAAGG 2029 Acc761 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGATCCAAGG 2029 K60_Pik-p GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc130 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc108 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc719 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc729 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc709 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc710 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc504 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc848 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc563 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc757 GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Tsuyuake_Pik-m GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Kanto51_Pik GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Kusabue_Pik GTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCCAAGG 2023 Acc201 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc206 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc1 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc101 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc718 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc724 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc715 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc706 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc624 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc440 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 2008 Acc868 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 2008 Acc220 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Nipponbare -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 AccUP3 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 AccUP1 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 Acc224 -TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA G 1993 ******************* ***********.******* ******.. * Ashikawa et al. Supplementary Fig. S1 (18/30)

19 Acc414 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2089 Acc420 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2089 Acc761 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2089 K60_Pik-p GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc130 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc108 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc719 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc729 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc709 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc710 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc504 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc848 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc563 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc757 GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Tsuyuake_Pik-m GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Kanto51_Pik GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Kusabue_Pik GAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAGGATA 2083 Acc201 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 Acc206 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 Acc1 GAGTCCCCTTGAATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 Acc101 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 Acc718 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 Acc724 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGACAATCTCGATA 2053 Acc715 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGACAATCTCGATA 2053 Acc706 GAGTCCCCTAGGATATGTTTAAAAGATGGCGAGTGTTGGACCTTGAAGACAATCTCGATA 2053 Acc624 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGACAATCTCGATA 2053 Acc440 GAGTCCCCTTGAATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2068 Acc868 GAGTCCCCTTGAATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2068 Acc220 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 Nipponbare GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 AccUP3 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 AccUP1 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 Acc224 GAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATCGGTA 2053 **.******: **********..*.* ********************* ***.: *.** Acc414 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2143 Acc420 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2143 Acc761 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2143 K60_Pik-p TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc130 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc108 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc719 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc729 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc709 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc710 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc504 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc848 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc563 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc757 TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Tsuyuake_Pik-m TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Kanto51_Pik TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Kusabue_Pik TACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG---AGGT 2137 Acc201 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc206 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc1 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc101 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc718 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc724 TAGATGACTCTCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc715 TAGATGACTCTCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc706 TAGATGACTCTCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc624 TAGATGACTCTCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc440 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2128 Acc868 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2128 Acc220 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Nipponbare TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 AccUP3 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 AccUP1 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 Acc224 TAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTCAAGT 2113 ** * ** ** ** ***.**.. ********.*** ** ********. ** *.** Ashikawa et al. Supplementary Fig. S1 (19/30)

20 Acc414 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2203 Acc420 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2203 Acc761 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2203 K60_Pik-p ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc130 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc108 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc719 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc729 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc709 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc710 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc504 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc848 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc563 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc757 ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Tsuyuake_Pik-m ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Kanto51_Pik ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Kusabue_Pik ACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTGAAGC 2197 Acc201 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc206 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc1 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc101 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc718 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc724 ACCTGGGTATCAAGGGTACACGGATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc715 ACCTGGGTATCAAGGGTACACGGATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc706 ACCTGGGTATCAAGGGTACACGGATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc624 ACCTGGGTATCAAGGGTACACGGATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc440 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2188 Acc868 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2188 Acc220 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Nipponbare ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 AccUP3 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 AccUP1 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 Acc224 ACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTGAAGC 2173 **** ***.*******:**.**.***. :********:********...*********** Acc414 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2263 Acc420 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2263 Acc761 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2263 K60_Pik-p ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc130 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc108 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc719 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc729 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc709 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc710 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc504 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc848 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc563 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc757 ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Tsuyuake_Pik-m ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Kanto51_Pik ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Kusabue_Pik ATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATTGGAG 2257 Acc201 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATCGGGG 2233 Acc206 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATCGGGG 2233 Acc1 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCAAAGAGCTCCCACGGGAGATCGGGG 2233 Acc101 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCACAGGAGATCGGGG 2233 Acc718 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCACAGGAGATCGGGG 2233 Acc724 ATCTGGAGATTTTGTACGTGAGGAGCACAGGCATCAAAGAGCTCCCACGGGAGATCGGGG 2233 Acc715 ATCTGGAGATTTTGTACGTGAGGAGCACAGGCATCAAAGAGCTCCCACGGGAGATCGGGG 2233 Acc706 ATCTGGAGATTTTGTACGTGAGGAGCACAGGCATCAAAGAGCTCCCACGGGAGATCGGGG 2233 Acc624 ATCTGGAGATTTTGTACGTGAGGAGCACAGGCATCAAAGAGCTCCCACGGGAGATCGGGG 2233 Acc440 AACTAGAGATTTTGTACGTGAGGAGCACAGGCATCAAAGAGCTCCCACGGGAGATCGGGG 2248 Acc868 AACTAGAGATTTTGTACGTGAGGAGCACAGGCATCAAAGAGCTCCCACGGGAGATCGGGG 2248 Acc220 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATCGGGG 2233 Nipponbare AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATCGGGG 2233 AccUP3 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATCGGGG 2233 AccUP1 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATCGGGG 2233 Acc224 AACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATCGGGG 2233 *: *.*********** ***.*******: * ***..:**.** **...***** **.* Ashikawa et al. Supplementary Fig. S1 (20/30)Ashikawa et al. Supplementary Fig.

21 Acc414 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2323 Acc420 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2323 Acc761 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2323 K60_Pik-p AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc130 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc108 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc719 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc729 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc709 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc710 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc504 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc848 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc563 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc757 AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Tsuyuake_Pik-m AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Kanto51_Pik AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Kusabue_Pik AGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCACTGC 2317 Acc201 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc206 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc1 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc101 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCAGATCAGCGAGCTCCCGTCGC 2293 Acc718 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCAGATCAGCGAGCTCCCGTCGC 2293 Acc724 AATTGAAACAACTGCGGACTCTGGACATGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc715 AATTGAAACAACTGCGGACTCTGGACATGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc706 AATTGAAACAACTGCGGACTCTGGACATGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc624 AATTGAAACAACTGCGGACTCTGGACATGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc440 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGTGAGCTCCCGTCGC 2308 Acc868 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGTGAGCTCCCGTCGC 2308 Acc220 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Nipponbare AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 AccUP3 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 AccUP1 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 Acc224 AATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCGTCGC 2293 *. ****.**:******* *******.****.******. **** ********. ** Acc414 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACGCCAA---TCA 2377 Acc420 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACGCCAA---TCA 2377 Acc761 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACGCCAA---TCA 2377 K60_Pik-p AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc130 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc108 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc719 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc729 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc709 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc710 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc504 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc848 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc563 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc757 AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Tsuyuake_Pik-m AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Kanto51_Pik AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACGCCAA---TCA 2371 Kusabue_Pik AGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAA---CACTCCAA---TCA 2371 Acc201 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 Acc206 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 Acc1 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 Acc101 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 Acc718 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 Acc724 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACAACATGTGGAATATCA 2353 Acc715 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACAACATGTGGAATATCA 2353 Acc706 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACAACATGTGGAATATCA 2353 Acc624 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACAACATGTGGAATATCA 2353 Acc440 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2365 Acc868 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2365 Acc220 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 Nipponbare AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 AccUP3 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 AccUP1 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 Acc224 AGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAA---CATGTGGAATATCA 2350 ****. *******.*.*******. ************** ** **.* *** Ashikawa et al. Supplementary Fig. S1 (21/30)

22 Acc414 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2437 Acc420 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2437 Acc761 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2437 K60_Pik-p GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc130 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc108 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc719 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc729 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc709 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc710 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc504 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc848 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc563 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc757 GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Tsuyuake_Pik-m GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Kanto51_Pik GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Kusabue_Pik GTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGCA 2431 Acc201 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCT Acc206 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCT Acc1 GCGAGCTGCCGTTGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAACA 2410 Acc101 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCT Acc718 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAACA 2410 Acc724 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAATA 2413 Acc715 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAATA 2413 Acc706 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCT Acc624 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCT Acc440 GCAAGCTGCCGTCGCAAATCGGGGAGCTAAAGCATCT Acc868 GCAAGCTGCCGTCGCAAATCGGGGAGCTAAAGCATCT Acc220 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAACA 2410 Nipponbare GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAACA 2410 AccUP3 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAACA 2410 AccUP1 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAACA 2410 Acc224 GCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCT *.**** *** ***..* **.****..**.**** Acc414 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGATTCTGGACG 2497 Acc420 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGATTCTGGACG 2497 Acc761 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGATTCTGGACG 2497 K60_Pik-p CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc130 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc108 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc719 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc729 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc709 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc710 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc504 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc848 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc563 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc757 CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Tsuyuake_Pik-m CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Kanto51_Pik CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Kusabue_Pik CTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGACG 2491 Acc GCGGACTCTGGATG 2401 Acc GCGGACTCTGGATG 2401 Acc1 CGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGATG 2470 Acc GCGGACTCTGGATG 2401 Acc718 CGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGATG 2470 Acc724 CGTCGGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGATG 2473 Acc715 CGTCGGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGATG 2473 Acc GCGGACTCTGGATG 2404 Acc GCGGACTCTGGATG 2404 Acc GCGGACTCTGGATG 2416 Acc GCGGACTCTGGATG 2416 Acc220 CGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGATG 2470 Nipponbare CGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGATG 2470 AccUP3 CGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGTCTCTGGATG 2470 AccUP1 CGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGTCTCTGGATG 2470 Acc GCGGACTCTGGATG 2401.*.*: ****** * Ashikawa et al. Supplementary Fig. S1 (22/30)

23 Acc414 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2557 Acc420 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2557 Acc761 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2557 K60_Pik-p TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc130 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc108 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc719 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc729 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc709 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc710 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc504 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc848 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc563 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc757 TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Tsuyuake_Pik-m TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Kanto51_Pik TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Kusabue_Pik TGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTGC 2551 Acc201 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2461 Acc206 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2461 Acc1 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2530 Acc101 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2461 Acc718 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2530 Acc724 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2533 Acc715 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2533 Acc706 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2464 Acc624 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2464 Acc440 TGAGGAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2476 Acc868 TGAGGAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2476 Acc220 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2530 Nipponbare TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2530 AccUP3 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2530 AccUP1 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2530 Acc224 TGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTGC 2461 ****.******.*************************************.**** *** Acc414 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2617 Acc420 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2617 Acc761 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2617 K60_Pik-p GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc130 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc108 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc719 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc729 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc709 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc710 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc504 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc848 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc563 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc757 GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Tsuyuake_Pik-m GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Kanto51_Pik GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Kusabue_Pik GCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCTC 2611 Acc201 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2521 Acc206 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2521 Acc1 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2590 Acc101 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2521 Acc718 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2590 Acc724 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2593 Acc715 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2593 Acc706 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2524 Acc624 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2524 Acc440 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2536 Acc868 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2536 Acc220 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2590 Nipponbare ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2590 AccUP3 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2590 AccUP1 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2590 Acc224 ACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGATC 2521.*****:*.*.*.********.*** ***.***** ****.********.*******.** Ashikawa et al. Supplementary Fig. S1 (23/30)

24 Acc414 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2677 Acc420 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2677 Acc761 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2677 K60_Pik-p TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc130 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc108 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc719 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc729 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc709 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc710 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc504 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc848 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc563 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc757 TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Tsuyuake_Pik-m TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Kanto51_Pik TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Kusabue_Pik TGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCGA 2671 Acc201 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2581 Acc206 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2581 Acc1 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2650 Acc101 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2581 Acc718 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2650 Acc724 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2653 Acc715 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2653 Acc706 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2584 Acc624 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2584 Acc440 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2596 Acc868 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2596 Acc220 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2650 Nipponbare TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2650 AccUP3 TGATCAAGGGTATTCCCAAGGCTGAGCTGGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2650 AccUP1 TGATCAAGGGTATTCCCAAGGCTGAGCTGGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2650 Acc224 TGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAATA 2581 ******* ********...****..** *****.***** ***** **.******.. * Acc414 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2737 Acc420 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2737 Acc761 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2737 K60_Pik-p TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc130 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc108 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc719 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc729 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc709 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc710 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc504 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc848 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc563 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc757 TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Tsuyuake_Pik-m TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Kanto51_Pik TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Kusabue_Pik TCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATGC 2731 Acc201 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2641 Acc206 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2641 Acc1 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2710 Acc101 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2641 Acc718 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2710 Acc724 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2713 Acc715 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2713 Acc706 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2644 Acc624 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2644 Acc440 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2656 Acc868 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2656 Acc220 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2710 Nipponbare TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2710 AccUP3 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2710 AccUP1 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2710 Acc224 TTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAGA 2641 *.**********.*** ****** *.**** ********.***. ***: ** *:*. Ashikawa et al. Supplementary Fig. S1 (24/30)

25 Acc414 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2797 Acc420 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2797 Acc761 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2797 K60_Pik-p GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc130 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc108 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc719 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc729 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc709 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc710 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc504 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc848 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc563 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc757 GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Tsuyuake_Pik-m GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Kanto51_Pik GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Kusabue_Pik GTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTCT 2791 Acc201 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2701 Acc206 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2701 Acc1 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2770 Acc101 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2701 Acc718 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2770 Acc724 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2773 Acc715 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2773 Acc706 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2704 Acc624 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2704 Acc440 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2716 Acc868 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2716 Acc220 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2770 Nipponbare GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2770 AccUP3 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2770 AccUP1 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2770 Acc224 GTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGGT 2701 ***********.********** ** ***.. ********** ************** * Acc414 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2854 Acc420 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2854 Acc761 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2854 K60_Pik-p GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc130 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc108 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc719 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc729 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc709 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc710 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc504 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc848 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc563 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc757 GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Tsuyuake_Pik-m GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Kanto51_Pik GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Kusabue_Pik GCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA---TGCCCAACCTGCAGA 2848 Acc201 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2761 Acc206 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2761 Acc1 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2830 Acc101 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2761 Acc718 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2830 Acc724 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2833 Acc715 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2833 Acc706 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2764 Acc624 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2764 Acc440 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2776 Acc868 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2776 Acc220 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2830 Nipponbare ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2830 AccUP3 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2830 AccUP1 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2830 Acc224 ACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAGA 2761.*.*******:***** ********:.**** **.***.* * **** ***** **** Ashikawa et al. Supplementary Fig. S1 (25/30)

26 Acc414 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2914 Acc420 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2914 Acc761 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2914 K60_Pik-p CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc130 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc108 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc719 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc729 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc709 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc710 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc504 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc848 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc563 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc757 CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Tsuyuake_Pik-m CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Kanto51_Pik CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Kusabue_Pik CGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGCT 2908 Acc201 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2821 Acc206 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2821 Acc1 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2890 Acc101 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2821 Acc718 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2890 Acc724 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2893 Acc715 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2893 Acc706 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2824 Acc624 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2824 Acc440 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2836 Acc868 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2836 Acc220 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2890 Nipponbare TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2890 AccUP3 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2890 AccUP1 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2890 Acc224 TGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGCT 2821 *** **.**************** **.**** *.*****.* *** *** ********* Acc414 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2974 Acc420 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2974 Acc761 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2974 K60_Pik-p TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc130 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc108 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc719 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc729 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc709 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc710 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc504 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc848 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc563 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Acc757 TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Tsuyuake_Pik-m TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAAG 2968 Kanto51_Pik TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGTTGCCAAGGATAGCCTTCCATGAAG 2968 Kusabue_Pik TCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGTTGCCAAGGATAGCCTTCCATGAAG 2968 Acc201 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2881 Acc206 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2881 Acc1 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2950 Acc101 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2881 Acc718 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2950 Acc724 TCCAGATGATGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGCTAACCTTCCAGGAAG 2953 Acc715 TCCAGATGATGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGCTAACCTTCCAGGAAG 2953 Acc706 TCCAGATGATGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGCTAACCTTCCAGGAAG 2884 Acc624 TCCAGATGATGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGCTAACCTTCCAGGAAG 2884 Acc440 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2896 Acc868 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2896 Acc220 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2950 Nipponbare TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2950 AccUP3 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2950 AccUP1 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2950 Acc224 TCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAAG 2881 ********.*******.**** *** ** ****** *****.**.**.******* **** Ashikawa et al. Supplementary Fig. S1 (26/30)

27 Acc414 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3034 Acc420 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3034 Acc761 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3034 K60_Pik-p ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc130 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc108 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc719 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc729 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc709 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc710 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc504 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc848 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc563 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc757 ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Tsuyuake_Pik-m ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Kanto51_Pik ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Kusabue_Pik ACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAACG 3028 Acc201 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAAG 2941 Acc206 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAAG 2941 Acc1 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 3010 Acc101 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAACAAAG 2941 Acc718 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAACAAAG 3010 Acc724 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 3013 Acc715 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 3013 Acc706 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 2944 Acc624 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 2944 Acc440 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 2956 Acc868 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 2956 Acc220 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAAG 3010 Nipponbare GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAAG 3010 AccUP3 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAAG 3010 AccUP1 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTCAAGTTCTACGCTGGCCCACCAAGCAAAG 3010 Acc224 GAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAAG *********** *******:********* *********** ****** ***.***.* Acc414 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3094 Acc420 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3094 Acc761 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3094 K60_Pik-p ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc130 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc108 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc719 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc729 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc709 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc710 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc504 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc848 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc563 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc757 ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Tsuyuake_Pik-m ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Kanto51_Pik ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Kusabue_Pik ATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCAT 3088 Acc201 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3001 Acc206 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3001 Acc1 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3070 Acc101 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3001 Acc718 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3070 Acc724 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3073 Acc715 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3073 Acc706 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3004 Acc624 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3004 Acc440 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3016 Acc868 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3016 Acc220 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3070 Nipponbare ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3070 AccUP3 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3070 AccUP1 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3070 Acc224 ATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAAT 3001 ** ****.**.******.**** ************************** *****..** Ashikawa et al. Supplementary Fig. S1 (27/30)

28 Acc414 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3154 Acc420 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3154 Acc761 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3154 K60_Pik-p GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc130 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc108 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc719 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc729 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc709 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc710 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc504 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc848 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc563 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc757 GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Tsuyuake_Pik-m GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Kanto51_Pik GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Kusabue_Pik GGTACAAGAGCGACGCCCCTGGCATCAGCGCCACCATTGACGTCGTGAAGAAAGAAGCCG 3148 Acc201 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3061 Acc206 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3061 Acc1 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3130 Acc101 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3061 Acc718 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3130 Acc724 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3133 Acc715 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3133 Acc706 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3064 Acc624 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3064 Acc440 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3076 Acc868 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3076 Acc220 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3130 Nipponbare GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3130 AccUP3 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3130 AccUP1 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3130 Acc224 GGTACAAGAGCGACAACCCTGGCATCAAGGCTGCCATTGACGTCGTGAAGAAAGAAGCAA 3061 **************..***********. **.*************************.. Acc414 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3214 Acc420 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3214 Acc761 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3214 K60_Pik-p AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc130 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc108 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc719 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc729 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc709 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc710 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc504 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc848 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc563 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc757 AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Tsuyuake_Pik-m AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Kanto51_Pik AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Kusabue_Pik AGGAGCATCCCAACCGGCCGATCACCCTCCTCATCAATGCTGGGTATAAGGAGATATCAA 3208 Acc201 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3121 Acc206 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3121 Acc1 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3190 Acc101 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3121 Acc718 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3190 Acc724 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCAA 3193 Acc715 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCAA 3193 Acc706 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCAA 3124 Acc624 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCAA 3124 Acc440 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3136 Acc868 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3136 Acc220 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3190 Nipponbare GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3190 AccUP3 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3190 AccUP1 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3190 Acc224 GGCAGCATCCCAACCGGCCGATCAGCCTTCTCATCACTGAGGGCGATAAGGAGGTACCGA 3121.* ********************* *** *******.**. ** ********.** *.* Ashikawa et al. Supplementary Fig. S1 (28/30)

29 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3271 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3271 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3271 K60_Pik-p ---CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Tsuyuake_Pik-m ---CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Kanto51_Pik ---CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Kusabue_Pik ---CTGAGTCACACGGGAGCAGTGAAAACATTGCGGGCAGCAGTGGGATCGATACTGAGC 3265 Acc201 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3172 Acc206 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3172 Acc1 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACACTGCTC 3241 Acc101 ATATTGAGGCACACGGGAGCAGTGAAAATATTGT------CGTTG---TCCACGCTGCTC 3172 Acc718 ATATTGAGGCACACGGGAGCAGTGAAAATATTGT------CGTTG---TCCACGCTGCTC 3241 Acc724 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3244 Acc715 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3244 Acc706 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3175 Acc624 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3175 Acc440 ATATTGAGGCACACGGGAGCAGTGTAAACATTGT------CGTTG---TCCACGCTGCTC 3187 Acc868 ATATTGAGGCACACGGGAGCAGTGTAAACATTGT------CGTTG---TCCACGCTGCTC 3187 Acc220 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3241 Nipponbare ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3241 AccUP3 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3241 AccUP1 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACACTGCTC 3241 Acc224 ATATTGAGGCACACGGGAGCAGTGAAAACATTGT------CGTTG---TCCACGCTGCTC 3172 **** ***************:*** **** *. ** ** *.***. * Acc414 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3329 Acc420 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3329 Acc761 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3329 K60_Pik-p CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc130 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc108 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc719 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc729 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc709 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc710 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc504 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc848 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc563 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc757 CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Tsuyuake_Pik-m CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Kanto51_Pik CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Kusabue_Pik CTGCACAGGCACAGCATGATAATCTCCCTGCTGTTCGAGATG--ACTACAAGGGAAAAGG 3323 Acc201 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3229 Acc206 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3229 Acc1 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3298 Acc101 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAACAGG 3229 Acc718 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAACAGG 3298 Acc724 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3301 Acc715 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3301 Acc706 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3232 Acc624 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3232 Acc440 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3244 Acc868 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3244 Acc220 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3298 Nipponbare CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3298 AccUP3 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3298 AccUP1 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3298 Acc224 CTG-AC-GACGCCATCAGTTGCTCTAGCTGC-GGCCGAACCAGCACTAGTATCCAAGAGG 3229 *** ** *.*.*...:*:*..***. **** * ***... **** :* ** *** Ashikawa et al. Supplementary Fig. S1 (29/30)

30 Acc414 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3389 Acc420 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3389 Acc761 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3389 K60_Pik-p GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc130 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc108 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc719 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc729 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc709 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc710 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc504 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc848 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc563 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc757 GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Tsuyuake_Pik-m GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Kanto51_Pik GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Kusabue_Pik GATTCTTCTTGATGGCAGGTGTCCTACCTGCGGCCGAGCGACTAAAATTGAAGAGGAAAC 3383 Acc201 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc206 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc1 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc101 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc718 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc724 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc715 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc706 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc624 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc440 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc868 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc220 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Nipponbare GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG AccUP3 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG AccUP1 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG Acc224 GAACAGTCC-GAGATCGAATA--CCAGCTATGG ATTTGTTCTGG **:. ** **. *...*. * * **. ** *:***:: :** Acc414 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3438 Acc420 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3438 Acc761 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3438 K60_Pik-p CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc130 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc108 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc719 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc729 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc709 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc710 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc504 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc848 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc563 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc757 CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Tsuyuake_Pik-m CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Kanto51_Pik CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Kusabue_Pik CCAAGATCGAGTAGCAGATATTGAAATTCAAACAGAAACTACTAGCTAG 3432 Acc201 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc206 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc1 CCGGAGTT---TAACAGCTATGAAAAGGCAAAAAGAAACTAG Acc101 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc718 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc724 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc715 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc706 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc624 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc440 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Acc868 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAC Acc220 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG Nipponbare CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG AccUP3 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG AccUP1 CCGGAGTT---TAACAGCTATGAAAAGGCAAAAAGAAACTAG Acc224 CCGGAGTT---TAACAGCTATGAAAAAGCAAAAAGAAACTAG **....* **.***.***.*** ****.******** Ashikawa et al. Supplementary Fig. S1 (30/30)


Download ppt "Acc414 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc420 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA 57 Acc761 ATGGAGGCGGCTGCCATGGCCGTA---ACCGCAGCCACGGGGGCCTTGGCGCCCGTGCTA."

Similar presentations


Ads by Google