Presentation is loading. Please wait.

Presentation is loading. Please wait.

IR50 (indica, -) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Kanto 51 (japonica, Pik) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC.

Similar presentations


Presentation on theme: "IR50 (indica, -) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Kanto 51 (japonica, Pik) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC."— Presentation transcript:

1 IR50 (indica, -) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Kanto 51 (japonica, Pik) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Shinriki (japonica, Piks) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Tsuyuake (japonica, Pikm) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Shin 2 (japonica, Piks) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Norin 18 (japonica, Piks) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Kinmaze (japonica, -) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC K60 (indica, Pikp) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC K3 (indica, Pikh) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Ishikarishiroke (japonica, Piks) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Akage (japonica, -) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC IR8 (indica, Piks) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Aichiasahi (japonica, -) ACAATGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG- Nipponbare (japonica, -) ACAATGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG- Norin 22 (japonica, -) ACAATGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG- Sensho (japonica, -) ACAATGGCGATTCGCCGGCTTTGTCTTCAAAGGGGGTACCCAATGAAATGCTTCTCAAG- *** * ************ * ****** ******* *** ** * ***** ***** IR50 ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGATCC Kanto 51 ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Shinriki ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Tsuyuake ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Shin 2 ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Norin 18 ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Kinmaze ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC K60 ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC K3 ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Ishikarishiroke ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Akage ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC IR8 ATGAGTATGGATGTGTCACACACTTGCAGCCTTGTCGTCCTTGGTGACGTGGCGCGACCC Aichiasahi -----TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA Nipponbare -----TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA Norin TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA Sensho -----TATGGATGTGTCACACACTCGCAGCCTTGTCATCCTTGGCGACGTGATA ******************* *********** ******* ****** IR50 AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Kanto 51 AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Shinriki AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Tsuyuake AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Shin 2 AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Norin 18 AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Kinmaze AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG K60 AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG K3 AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Ishikarishiroke AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Akage AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG IR8 AAGGGAATCCCCTTCTATATGTTTAAGCGCTTGCGAGTGTTGGACCTTGAAGATAATAAG Aichiasahi ---GGAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATC Nipponbare ---GGAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATC Norin GGAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATC Sensho ---GGAGTCCCCTTGGATATGTTTAAAAGATTGCGAGTGTTGGACCTTGAAGATAATATC *** ******* ********** * **************************** Fig. S1a. DNA sequence alignment of the Pikm1-TS LRR region in set 1 cultivars. In parentheses, indica and japonica indicate the cultivar origin of the sequenced region, the name of any resistance gene follows; a minus sign (-) indicates that no Pik multiple-allele gene has been reported. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1a (1/7)

2 IR50 GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Kanto 51 GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Shinriki GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Tsuyuake GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Shin 2 GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Norin 18 GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Kinmaze GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- K60 GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- K3 GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Ishikarishiroke GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Akage GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- IR8 GATATACAGGATTCTCATCTGCAGGGCATATGTGAACAGTTA---AGCCTCAGAGTG--- Aichiasahi GGTATAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTC Nipponbare GGTATAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTC Norin 22 GGTATAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTC Sensho GGTATAGAGGACTCCCACCTGAAGAAGATATGTGAGCAGCTAGAGAGCCTCAGGCTGCTC * **** **** ** ** *** ** ******** *** ** ******** ** IR50 AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Kanto 51 AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Shinriki AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Tsuyuake AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Shin 2 AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Norin 8 AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Kinmaze AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG K60 AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG K3 AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Ishikarishiroke AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Akage AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG IR8 AGGTACCTTGGTCTCAAGGGAACGCGGATCCGAAAGCTCCCTCAGGAGATGAGGAAGCTG Aichiasahi AAGTACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTG Nipponbare AAGTACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTG Norin 22 AAGTACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTG Sensho AAGTACCTAGGTCTCAAGGGTACGCGAATCACTAAGCTCCCACAGGAGATACAGAAGCTG * ****** *********** ***** *** ******** ******** ******* IR50 AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Kanto 51 AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Shinriki AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Tsuyuake AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Shin 2 AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Norin 18 AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Kinmaze AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT K60 AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT K3 AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Ishikarishiroke AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Akage AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT IR8 AAGCATTTGGAGATTTTGTATGTGGGGAGCACTCGGATCAGTGAACTTCCGCAAGAGATT Aichiasahi AAGCAACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATC Nipponbare AAGCAACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATC Norin 22 AAGCAACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATC Sensho AAGCAACTGGAGATTTTGTACGTGAGGAGCACAGGCATCGAAGAGCTCCCATGGGAGATC ***** ************* *** ******* * *** ** ** ** ***** Fig. S1a. DNA sequence alignment of the Pikm1-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1a (2/7)

3 IR50 GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Kanto 51 GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Shinriki GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Tsuyuake GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Shin 2 GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Norin 18 GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Kinmaze GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA K60 GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA K3 GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Ishikarishiroke GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Akage GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA IR8 GGAGAGCTGAAGCATCTGCGGATTCTGGACGTGAGAAACACGGACATCACTGAGCTCCCA Aichiasahi GGGGAATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCG Nipponbare GGGGAATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCG Norin 22 GGGGAATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCG Sensho GGGGAATTGAAACAACTGCGGACTCTGGACGTGAGGAACACGCGGATCAGCGAGCTCCCG ** ** **** ** ******* ************ ****** **** ******** IR50 CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACGCCAA---TC Kanto 51 CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACGCCAA---TC Shinriki CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC Tsuyuake CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC Shin 2 CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC Norin 18 CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC Kinmaze CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC K60 CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC K3 CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC Ishikarishiroke CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC Akage CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC IR8 CTGCAGATACGGGAGCTGCAGCATCTGCACACTCTGGACGTGAGGAACACTCCAA---TC Aichiasahi TCGCAGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACATGTGGAATATC Nipponbare TCGCAGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACATGTGGAATATC Norin 22 TCGCAGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACATGTGGAATATC Sensho TCGCAGATCGGGGAGCTCAAACATCTGCGGACTCTGGACGTGAGTAACATGTGGAATATC ****** ******* * ******* ************** **** * ** IR50 AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Kanto 51 AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Shinriki AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Tsuyuake AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Shin 2 AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Norin 18 AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Kinmaze AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC K60 AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC K3 AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Ishikarishiroke AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Akage AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC IR8 AGTGAGCTCCCGCCGCAGGTTGGCAAGCTGCAGAATCTCAAGATTATGTGCGTGAGGAGC Aichiasahi AGCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAAC Nipponbare AGCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAAC Norin 22 AGCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAAC Sensho AGCGAGCTGCCGTCGCAAATCGGGGAGCTGAAGCATCTACAAACTCTGGATGTGAGGAAC ** ***** *** **** * ** ***** ** **** * * * ** ******* * Fig. S1a. DNA sequence alignment of the Pikm1-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2in blue. Ashikawa et al. Supplementary figure S1a (3/7)

4 IR50 ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGATTCTGGAC Kanto 51 ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Shinriki ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Tsuyuake ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Shin 2 ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Norin 18 ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Kinmaze ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC K60 ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC K3 ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Ishikarishiroke ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Akage ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC IR8 ACTGGGGTTAGGGAGCTCCCAAAGGAGATTGGGGAGCTGAATCATCTACAGACTCTGGAC Aichiasahi ACGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGAT Nipponbare ACGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGAT Norin 22 ACGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGACTCTGGAT Sensho ACGTCAGTGAGAGAGCTGCCATCGCAAATCGGGGAGCTGAAGCATCTGCGGTCTCTGGAT ** ** ** ***** *** * * ** *********** ***** * * ****** IR50 GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Kanto 51 GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Shinriki GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Tsuyuake GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Shin 2 GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Norin 18 GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Kinmaze GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG K60 GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG K3 GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Ishikarishiroke GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Akage GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG IR8 GTGAGAAACACGAGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCCCAATCGTTG Aichiasahi GTGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTG Nipponbare GTGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTG Norin 22 GTGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTG Sensho GTGAGGAACACGGGGGTGAGAGAGCTGCCATGGCAAGCTGGCCAGATCTCGGGATCGCTG ***** ****** ************************************* **** ** IR50 CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Kanto 51 CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Shinriki CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Tsuyuake CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Shin 2 CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Norin 18 CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Kinmaze CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT K60 CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT K3 CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Ishikarishiroke CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Akage CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT IR8 CGCGTGCTTGCCGGTGACAGTGGCGATGGCGTGCGGTTGCCCGAAGGCGTCTGCGAAGCT Aichiasahi CACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGAT Nipponbare CACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGAT Norin 22 CACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGAT Sensho CACGTGCATACAGATGACAGTGACGAGGGCATGCGGCTGCCAGAAGGCGTATGCGAAGAT * ***** * * * ******** *** *** ***** **** ******** ******* * Fig. S1a. DNA sequence alignment of the Pikm1-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1a (4/7)

5 IR50 CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Kanto 51 CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Shinriki CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Tsuyuake CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Shin 2 CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Norin 18 CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Kinmaze CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG K60 CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG K3 CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Ishikarishiroke CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Akage CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG IR8 CTGATCAACGGTATTCCAGGGGCTACGCGTGCAAAATGCAGGGAGGTTCTGTCCATCGCG Aichiasahi CTGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAAT Nipponbare CTGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAAT Norin 22 CTGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAAT Sensho CTGATCAAGGGTATTCCCAAGGCTGAGCTCGCAAAGTGCAGTGAGGTCCTATCCATCAAT ******** ******** **** ** ***** ***** ***** ** ****** IR50 ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Kanto 51 ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Shinriki ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Tsuyuake ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Shin 2 ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Norin 18 ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Kinmaze ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG K60 ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG K3 ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Ishikarishiroke ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Akage ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG IR8 ATCATCGATCGTTTCGGACCTCCCCTTGTTGGGATATTCAAAGTTCCCGGCAGTCATATG Aichiasahi ATTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAG Nipponbare ATTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAG Norin 22 ATTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAG Sensho ATTGTCGATCGTTTAGGATCTCCCCCTATTGGCATATTCAAGGTTATTGGCTTGCACAAG ** ********** *** ****** * **** ******** *** *** ** * * IR50 CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Kanto 51 CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Shinriki CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Tsuyuake CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Shin 2 CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Norin 18 CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Kinmaze CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC K60 CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC K3 CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Ishikarishiroke CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Akage CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC IR8 CGTATCCCGAAGATGATCAAAGACCACTTCCGCGTTCTTTCTTGCCTAGACATCAGGCTC Aichiasahi AGTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGG Nipponbare AGTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGG Norin 22 AGTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGG Sensho AGTATCCCGAAGCTGATCAAAGATCATTTCAATGTTCTTTCTTCCCTAGACATCAGGCGG *********** ********** ** *** ********** ************** Fig. S1a. DNA sequence alignment of the Pikm1-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1a (5/7)

6 IR50 TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Kanto 51 TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Shinriki TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Tsuyuake TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Shin 2 TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Norin 18 TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Kinmaze TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG K60 TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG K3 TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Ishikarishiroke TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Akage TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG IR8 TGCCACAAGCTTGAGGATGATGACCAAAAGTTCCTCGCCGAGA--- TGCCCAACCTGCAG Aichiasahi TACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAG Nipponbare TACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAG Norin 22 TACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAG Sensho TACAACAAGCTAGAGGAGGATGACCATGAGTTTCTAGCCAACAATATGCCTAACCTCCAG * * ******* ***** ******** **** ** *** * * **** ***** *** IR50 ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Kanto 51 ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Shinriki ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Tsuyuake ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Shin 2 ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Norin 18 ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Kinmaze ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC K60 ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC K3 ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Ishikarishiroke ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Akage ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC IR8 ACGCTCGTGCTGAGGTTCGAGGCCCTACCAAGACAACCCATAACCATCAACGGCACAGGC Aichiasahi ATGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGC Nipponbare ATGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGC Norin 22 ATGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGC Sensho ATGCTTGTACTGAGGTTCGAGGCCCCACAAAGAGAGCCCATCATCATTAACCGCACAGGC * *** ** **************** ** **** * ***** * *** *** ******** IR50 TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Kanto 51 TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGTTGCCAAGGATAGCCTTCCATGAA Shinriki TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Tsuyuake TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Shin 2 TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Norin 18 TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Kinmaze TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA K60 TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA K3 TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Ishikarishiroke TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Akage TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA IR8 TTCCAGATGCTGGAGAGCTTCCGTGTCGACAGCCGGGTGCCAAGGATAGCCTTCCATGAA Aichiasahi TTCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAA Nipponbare TTCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAA Norin 22 TTCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAA Sensho TTCCAGATGCTGGAGAGATTCCTTGTGGAGAGCCGGGTGCCACGGATAACCTTCCAGGAA ***************** **** *** ** ****** ***** ***** ******* *** Fig. S1a. DNA sequence alignment of the Pikm1-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1a (6/7)

7 IR50 GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Kanto 51 GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Shinriki GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Tsuyuake GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Shin 2 GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Norin 18 GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Kinmaze GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC K60 GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC K3 GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Ishikarishiroke GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Akage GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC IR8 GACGCCATGCCCAACCTCAAGCTTCTCGAGTTCAAGTTCTACGCCGGCCCAGCAAGCAAC Aichiasahi GGAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAA Nipponbare GGAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAA Norin 22 GGAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAA Sensho GGAGCCATGCCCAAGCTCAAGCATCTCGAGTTTAAGTTCTACGCTGGCCCACCAAGCAAA * *********** ******* ********* *********** ****** ******* IR50 GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Kanto 51 GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Shinriki GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Tsuyuake GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Shin 2 GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Norin 18 GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Kinmaze GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA K60 GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA K3 GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Ishikarishiroke GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Akage GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA IR8 GATGCCATCGGCATCACCAACCTGAAGAGCCTCCAAAAGGTGGTCTTTCGGTGCTCGCCA Aichiasahi GATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAA Nipponbare GATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAA Norin 22 GATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAA Sensho GATCCCATAGGAATCACCCACCTCAAGAGCCTCCAAAAGGTGGTCTTTCGCTGCTCCAAA *** **** ** ****** **** ************************** ***** * IR50 TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Kanto 51 TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Shinriki TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Tsuyuake TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Shin 2 TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Norin 18 TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Kinmaze TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC K60 TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC K3 TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Ishikarishiroke TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Akage TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC IR8 TGGTACAAGAGCGACGCCCCTGGCATCAGCGCC Aichiasahi TGGTACAAGAGCGACAACCCTGGCATCAAGGCT Nipponbare TGGTACAAGAGCGACAACCCTGGCATCAAGGCT Norin 22 TGGTACAAGAGCGACAACCCTGGCATCAAGGCT Sensho TGGTACAAGAGCGACAACCCTGGCATCAAGGCT *************** *********** ** Fig. S1a. DNA sequence alignment of the Pikm1-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1Aa(7/7)

8 K60 (indica, Pikp) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATATGCCATTC Kinmaze (japonica, -) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Ishikarishirake (japonica, Piks) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Akage (japonica, -) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Nourin 18 (japonica, Piks) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Shinriki (japonica, Piks) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Shin 2 (japonica, Piks) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC K3 (indica, Pikh) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Tsuyuake (japonica, Pikm) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Kanto 51 (japonica, Pik) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC IR8 (indica, Piks) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC IR50 (indica, -) CTGAACTTGGCTCAAGTGAGATCACTGACGGTGTTTGGGAACCTGAACCATGTGCCATTC Nipponbare (japonica, -) CTGAACTTGGCTCAAGTGCGATCACTGACGGTGTTTGGGAACCTGAACCATGTTCCATTC Aichiasahi (japonica, -) CTGAACTTGGCTCAAGTGCGATCACTGACGGTGTTTGGGAACCTGAACCATGTTCCATTC Nourin 22 (japonica, -) CTGAACTTGGCTCAAGTGCGATCACTGACGGTGTTTGGGAACCTGAACCATGTTCCATTC Sensyo (japonica, -) CTGAACTTGGCTCAAGTGCGATCACTGACGGTGTTTGGGAACCTGAACCATGTTCCATTC ****************** ******************************** * ****** K60 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Kinmaze CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Ishikarishirake CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Akage CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Nourin 18 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Shinriki CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Shin 2 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA K3 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Tsuyuake CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Kanto 51 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA IR8 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA IR50 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGACTGGAAGGGTTTGAAA Nipponbare CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGGTTGGAAGGGTTTGAAA Aichiasahi CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGGTTGGAAGGGTTTGAAA Nourin 22 CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGGTTGGAAGGGTTTGAAA Sensyo CATTCATTCAACTATGGGATAATACAGGTGCTGGATCTTGAGGGTTGGAAGGGTTTGAAA ******************************************* *************** K60 GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Kinmaze GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Ishikarishirake GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Akage GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Nourin 18 GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Shinriki GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Shin 2 GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA K3 GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Tsuyuake GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Kanto 51 GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA IR8 GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA IR50 GAGAGACATATGACGGAGATATGTCAAATGCTTTTACTCAAGTATTTGAGCATCCGACGA Nipponbare GAGAGACATGTGACGGAGATATGTCAAATGCTTGTACTCAAGTATTTGAGCATCCGGCGG Aichiasahi GAGAGACATGTGACGGAGATATGTCAAATGCTTGTACTCAAGTATTTGAGCATCCGGCGG Nourin 22 GAGAGACATGTGACGGAGATATGTCAAATGCTTGTACTCAAGTATTTGAGCATCCGGCGG Sensyo GAGAGACATGTGACGGAGATATGTCAAATGCTTGTACTCAAGTATTTGAGCATCCGGCGG ********* *********************** ********************** ** Fig. S1b. DNA sequence alignment of the Pikm2-TS LRR region in set 1 cultivars. In parentheses,indica and japonica indicate the cultivar origin of the sequenced region, and the name of any resistance gene follows; a minus sign (-) indicates no Pik multiple-allele gene has been reported. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1b (1/7)

9 K60 ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Kinmaze ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Ishikarishirake ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Akage ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Nourin 18 ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Shinriki ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Shin 2 ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC K3 ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Tsuyuake ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Kanto 51 ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC IR8 ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC IR50 ACAGAAATTTCCAAAATTCCCTCCAAGATTCAGAAACTTGAGTACTTGGAAACTCTTGAC Nipponbare ACAGAAATTGCCAAAATTCCCTCAAAGATTGAGAAACTTGAGTATTTGGAAACTCTTGAC Aichiasahi ACAGAAATTGCCAAAATTCCCTCAAAGATTGAGAAACTTGAGTATTTGGAAACTCTTGAC Nourin 22 ACAGAAATTGCCAAAATTCCCTCAAAGATTGAGAAACTTGAGTATTTGGAAACTCTTGAC Sensyo ACAGAAATTGCCAAAATTCCCTCAAAGATTGAGAAACTTGAGTATTTGGAAACTCTTGAC ********* ************* ****** ************* *************** K60 ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Kinmaze ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Ishikarishirake ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Akage ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Nourin 18 ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Shinriki ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Shin 2 ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT K3 ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Tsuyuake ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Kanto 51 ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT IR8 ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT IR50 ATAAGGGAGACATATGTCAGGGACCTGCCTAAGTCAATAGTCCAGCTAAAACGGATCATT Nipponbare ATAAGGGAGACATATGTCGAGGAGCTGCCTAAGTCTGTAGGCCAGCTAAAACGGATCAGT Aichiasahi ATAAGGGAGACATATGTCGAGGAGCTGCCTAAGTCTGTAGGCCAGCTAAAACGGATCAGT Nourin 22 ATAAGGGAGACATATGTCGAGGAGCTGCCTAAGTCTGTAGGCCAGCTAAAACGGATCAGT Sensyo ATAAGGGAGACATATGTCGAGGAGCTGCCTAAGTCTGTAGGCCAGCTAAAACGGATCAGT ****************** *** *********** *** ***************** * K60 AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Kinmaze AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Ishikarishirake AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Akage AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Nourin 18 AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Shinriki AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Shin 2 AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT K3 AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Tsuyuake AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Kanto 51 AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT IR8 AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT IR50 AGCATACTTGGAGGGAATAAAAACACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGT Nipponbare AGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGA Aichiasahi AGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGA Nourin 22 AGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGA Sensyo AGCATACTTGGGGGGAACAAAAATACACGGAAGGGGCTGAGGTTGCCTCAAGAAAAAAGA *********** ***** ***** *********************************** Fig. S1b. DNA sequence alignment of the Pikm2-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1b (2/7)

10 K60 AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Kinmaze AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Ishikarishirake AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Akage AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Nourin 18 AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Shinriki AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Shin 2 AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA K3 AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Tsuyuake AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Kanto 51 AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA IR8 AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA IR50 AAGAAGCCAATTAAAAACCCGTCGCCTCAAGGAAAAACAAAGGAGCCCGCAAAGAAAGGA Nipponbare AATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAGCCTGCAGAGAAAGGA Aichiasahi AATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAGCCTGCAGAGAAAGGA Nourin 22 AATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAGCCTGCAGAGAAAGGA Sensyo AATAAGGCAATGAAAAACCCGTCACCTCAAGGTAAAACAAAGGAGCCTGCAGAGAAAGGA ** *** **** *********** ******** ************** *** ******** K60 TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Kinmaze TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Ishikarishirake TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Akage TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Nourin 18 TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Shinriki TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Shin 2 TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT K3 TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Tsuyuake TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Kanto 51 TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT IR8 TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT IR50 TTCTTATCCCAAGAAAAAGGTAAAGGCGCAATGAAAGCACTCCGTGTACTGTCAGGGATT Nipponbare TTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGTGTACTGTCAGGGATT Aichiasahi TTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGTGTACTGTCAGGGATT Nourin 22 TTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGTGTACTGTCAGGGATT Sensyo TTCTTGTCCCAAGAAAAAGCTAAAGGCACAATGAAGTCACTCCGTGTACTGTCAGGGATT ***** ************* ******* ******* *********************** K60 GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Kinmaze GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Ishikarishirake GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Akage GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Nourin 18 GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Shinriki GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Shin 2 GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG K3 GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Tsuyuake GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Kanto 51 GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG IR8 GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG IR50 GAGATTGTTGAGGAATCATCAGAAGTAGCTGCAGGCCTTCATCAGTTGACAGGGCTAAGG Nipponbare GAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAGTTGACAGGACTAAGG Aichiasahi GAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAGTTGACAGGACTAAGG Nourin 22 GAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAGTTGACAGGACTAAGG Sensyo GAGATCGTTGATGAATCAGCAGCAGTAGCTGCAAGCCTTCATCAGTTGACAGGACTAAGG ***** ***** ****** *** ********** ******************* ****** Fig. S1b. DNA sequence alignment of the Pikm2-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1b (3/7)

11 K60 AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Kinmaze AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Ishikarishirake AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Akage AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Nourin 18 AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Shinriki AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Shin 2 AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG K3 AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Tsuyuake AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Kanto 51 AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG IR8 AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG IR50 AAGCTTGCCATATACAAGCTCAATATAACAAAGGGTGGTGATACCTTCAAACAATTACAG Nipponbare AAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACATTCAAAGAATTACTC Aichiasahi AAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACATTCAAAGAATTACTC Nourin 22 AAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACATTCAAAGAATTACTC Sensyo AAGCTTGCCATATACAAGCTCAAAATAAGCGAGGAAAATGATACATTCAAAGAATTACTC *********************** **** *** ****** ****** ****** K60 TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Kinmaze TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Ishikarishirake TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Akage TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Nourin 18 TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Shinriki TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Shin 2 TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT K3 TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Tsuyuake TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Kanto 51 TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT IR8 TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT IR50 TCCTCCATTGAGTACCTTGGCAGCTGTGGTCTGCAGACTCTGGCCATCAATGATGAGAAT Nipponbare TCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCCATCAATGATGAGAAT Aichiasahi TCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCCATCAATGATGAGAAT Nourin 22 TCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCCATCAATGATGAGAAT Sensyo TCCTCTATTGAGTACCTTGGCAGCTGCGGCCTGCAGACTCTGGCCATCAATGATGAGAAT ***** ******************** ** ****************************** K60 TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Kinmaze TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Ishikarishirake TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Akage TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Nourin 18 TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Shinriki TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Shin 2 TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT K3 TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Tsuyuake TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Kanto 51 TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT IR8 TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT IR50 TCTGAATTTATCAACTCACTGGGCGACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTT Nipponbare TCTAAATTTATCAACTCACTATACAACATGTCTGCACCTCCAAGATATCTAGTCTCCCTT Aichiasahi TCTAAATTTATCAACTCACTATACAACATGTCTGCACCTCCAAGATATCTAGTCTCCCTT Nourin 22 TCTAAATTTATCAACTCACTATACAACATGTCTGCACCTCCAAGATATCTAGTCTCCCTT Sensyo TCTAAATTTATCAACTCACTATACAACATGTCTGCACCTCCAAGATATCTAGTCTCCCTT *** **************** * ***** * ** ************** *** ***** Fig. S1b. DNA sequence alignment of the Pikm2-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1b(4/7)

12 K60 GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Kinmaze GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Ishikarishirake GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Akage GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Nourin 18 GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Shinriki GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Shin 2 GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC K3 GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Tsuyuake GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Kanto 51 GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC IR8 GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC IR50 GAGCTGTCTGGCAAGTTGGAGAAGCTACCCAAGTGGATCACCAGCATCACTACTCTCAAC Nipponbare GAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATCACCAGCATTACTACTCTCAAC Aichiasahi GAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATCACCAGCATTACTACTCTCAAC Nourin 22 GAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATCACCAGCATTACTACTCTCAAC Sensyo GAGCTGTCCGGCAAGTTGAAATGGCTACCTGAGTGGATCACCAGCATTACTACTCTCAAC ******** ********* * ****** **************** ************ K60 AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Kinmaze AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Ishikarishirake AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Akage AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Nourin 18 AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Shinriki AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Shin 2 AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA K3 AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Tsuyuake AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Kanto 51 AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA IR8 AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA IR50 AAGCTAACCATATCTGTAACAGTTCTTAGGACTGAAACTTTGGAGATCCTCCACATTTTA Nipponbare AAGTTAACCATATCTATAACAGTTCTTACGACTGAAACTTTGGAGATCCTCCGCAATTTA Aichiasahi AAGTTAACCATATCTATAACAGTTCTTACGACTGAAACTTTGGAGATCCTCCGCAATTTA Nourin 22 AAGTTAACCATATCTATAACAGTTCTTACGACTGAAACTTTGGAGATCCTCCGCAATTTA Sensyo AAGTTAACCATATCTATAACAGTTCTTACGACTGAAACTTTGGAGATCCTCCGCAATTTA *** *********** ************ *********************** ** **** K60 CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Kinmaze CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Ishikarishirake CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Akage CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Nourin 18 CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Shinriki CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Shin 2 CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC K3 CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Tsuyuake CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Kanto 51 CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC IR8 CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC IR50 CCTTCATTGTTTTCCCTCACCTTCGCCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGAC Nipponbare CCTTCATTGTTTTCCCTCACCTTTGCCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGAC Aichiasahi CCTTCATTGTTTTCCCTCACCTTTGCCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGAC Nourin 22 CCTTCATTGTTTTCCCTCACCTTTGCCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGAC Sensyo CCTTCATTGTTTTCCCTCACCTTTGCCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGAC *********************** ************************** ********* Fig. S1b. DNA sequence alignment of the Pikm2-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1b (5/7)

13 K60 ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Kinmaze ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Ishikarishirake ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Akage ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Nourin 18 ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Shinriki ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Shin 2 ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA K3 ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Tsuyuake ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Kanto 51 ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA IR8 ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA IR50 ATAATAAAGGACATCCTTGAGAATAATAAATTGGACAGTGATGGGGAAATCGTCATTCCA Nipponbare ACAGTAAAGGGCATCCTTGAGGACAATAAATTGGCCACTGACGGGGAAATCGTCATTCCA Aichiasahi ACAGTAAAGGGCATCCTTGAGGACAATAAATTGGCCACTGACGGGGAAATCGTCATTCCA Nourin 22 ACAGTAAAGGGCATCCTTGAGGACAATAAATTGGCCACTGACGGGGAAATCGTCATTCCA Sensyo ACAGTAAAGGGCATCCTTGAGGACAATAAATTGGCCACTGACGGGGAAATCGTCATTCCA * * ****** ********** * ********** ** *** ****************** K60 GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Kinmaze GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Ishikarishirake GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Akage GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Nourin 18 GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Shinriki GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Shin 2 GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC K3 GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Tsuyuake GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Kanto51 GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC IR8 GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC IR50 GCTGAAGGATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTC Nipponbare GCTAAAGAATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTC Aichiasahi GCTAAAGAATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTC Nourin22 GCTAAAGAATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTC Sensyo GCTAAAGAATTCAAGAGTCTTAAGCTGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTC *** *** *************************************** ***** ****** K60 AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Kinmaze AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Ishikarishirake AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Akage AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Nourin 18 AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Shinriki AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Shin 2 AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC K3 AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Tsuyuake AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Kanto 51 AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC IR8 AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC IR50 AGCTTTTTGGACAAGAATGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTAAAGAC Nipponbare AGCTTTCCGGACAAGAGTGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTCAAGAA Aichiasahi AGCTTTCCGGACAAGAGTGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTCAAGAA Nourin 22 AGCTTTCCGGACAAGAGTGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTCAAGAA Sensyo AGCTTTCCGGACAAGAGTGCAATGCCAGCACTCGAAATCATTGAAATGCGGTTTCAAGAA ****** ******** ************************************* **** Fig. S1b. DNA sequence alignment of the Pikm2-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1b (6/7)

14 K60 TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Kinmaze TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Ishikarishirake TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Akage TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Nourin 18 TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Shinriki TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Shin 2 TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT K3 TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Tsuyuake TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Kanto 51 TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT IR8 TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT IR50 TTCGAAGGTCTATTTGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Nipponbare TTTGAGGGTCTATTCGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Aichiasahi TTTGAGGGTCTATTCGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Nourin 22 TTTGAGGGTCTATTCGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT Sensyo TTTGAGGGTCTATTCGGCATCGAAATCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTT ** ** ******** ********************************************* K60 AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Kinmaze AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Ishikarishirake AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Akage AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Nourin 18 AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Shinriki AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Shin 2 AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG K3 AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Tsuyuake AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG Kanto 51 AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGTTAATACTGAG IR8 AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGATAATACTGAG IR50 AGTGATGGGGCAGAAGCAATAACCAAGTTCCTTGTAAATGATTTGAAGGATAATACTGAG Nipponbare AGCGATGGGGCAGAAGCAATAACCAAGTTCCTAGTAAGTGATTTGAAGGATAATACTGAG Aichiasahi AGCGATGGGGCAGAAGCAATAACCAAGTTCCTAGTAAGTGATTTGAAGGATAATACTGAG Nourin 22 AGCGATGGGGCAGAAGCAATAACCAAGTTCCTAGTAAGTGATTTGAAGGATAATACTGAG Sensyo AGCGATGGGGCAGAAGCAATAACCAAGTTCCTAGTAAGTGATTTGAAGGATAATACTGAG ** ***************************** **** *********** ********** K60 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Kinmaze AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Ishikarishirake AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Akage AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Nourin 18 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Shinriki AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Shin 2 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA K3 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Tsuyuake AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Kanto 51 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA IR8 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA IR50 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Nipponbare AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Aichiasahi AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Nourin 22 AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA Sensyo AAACCAAAAGTATTTGTTGATGGCATCGTCACTGCATGA *************************************** Fig. S1b. DNA sequence alignment of the Pikm2-TS LRR region in set 1 cultivars. Alleles classed into clade 1 are in green and those in clade 2 in blue. Ashikawa et al. Supplementary figure S1b (7/7)


Download ppt "IR50 (indica, -) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC Kanto 51 (japonica, Pik) CCAAGGTTGATTCGCCGGCTGTCTCTTCAGGGGGGGTATCCAGTGGACTGCTTGTCAAGC."

Similar presentations


Ads by Google