Presentation is loading. Please wait.

Presentation is loading. Please wait.

Acc414 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc420 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc761 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC.

Similar presentations


Presentation on theme: "Acc414 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc420 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc761 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC."— Presentation transcript:

1 Acc414 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc420 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc761 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc504 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc563 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc757 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc848 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Tsuyuake_Pikm ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Kusabue_Pik ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Kanto51_Pik ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 K60_Pikp ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc108 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc130 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc719 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc729 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc710 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc709 ATGGAGTTGGTGGTAGGTGCTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc220 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Nipponbare ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc224 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 AccUP3 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 AccUP1 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc206 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc201 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc724 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc415 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc417 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc435 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc712 ATGGAGTTGGCGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc101 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc715 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc706 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc624 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc1 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc440 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc868 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 Acc718 ATGGAGTTGGTGGTAGGTGCTTCGGAAGCCACCATGAGATCTCTCCTGGGCAAGCTGGGC 60 ********** ******** *** ************* ******* ************** Acc414 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc420 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc761 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc504 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc563 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc757 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc848 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Tsuyuake_Pikm AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Kusabue_Pik AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Kanto51_Pik AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 K60_Pikp AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc108 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc130 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc719 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc729 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc710 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc709 AATCTTCTAGCCCAGGAGTATGCTCTCATCAGCGGTATCCGTGGTGACATCCAGTACATC 120 Acc220 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Nipponbare AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc224 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 AccUP3 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 AccUP1 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc206 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc201 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc724 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc415 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc417 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc435 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc712 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc101 AACCTTCTTGCCCAGGAGTATGCTCTCATCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc715 AACCTTCTTGCCCAGGAGTATGCTCTCATCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc706 AACCTTCTTGCCCAGGAGTATGCTCTCATCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc624 AACCTTCTTGCCCAGGAGTATGCTCTCATCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc1 AACCTTCTTGCCCAGGAGTATGCTCTCATCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc440 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc868 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 Acc718 AACCTTCTTGCCCAGGAGTATTCTCTGGTCAGCGGCGTCCGTGGTGACATCCAGTACATC 120 ** ***** ************ **** ******* *********************** Fig. S2. Multiple alignment of the second-gene sequences of the 32 rice lines, cultivars showing Pik-family-specific blast resistance (Kusabue, Kanto 51, Tsuyuake, and K60) and the susceptible Nipponbare. Sequences grouped clade 1 are black, and those in clade 2 are red. Ashikawa et al. Supplementary Fig. S2 (1/28)

2 Acc414 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc420 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc761 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc504 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc563 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc757 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc848 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Tsuyuake_Pikm AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Kusabue_Pik AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Kanto51_Pik AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 K60_Pikp AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc108 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc130 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc719 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc729 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc710 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc709 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGATCTCAGCAACGTGCCAGAGGGT 180 Acc220 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Nipponbare AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc224 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 AccUP3 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 AccUP1 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc206 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc201 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc724 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc415 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc417 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc435 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc712 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTTAGCGTTGTGACGGAGGGT 180 Acc101 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 Acc715 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 Acc706 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 Acc624 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 Acc1 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 Acc440 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 Acc868 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 Acc718 AATGACGAGCTTGCCAGCATGCAGGCCTTCCTCCGTGACCTCAGCGTTTTGCCGGAGGGT 180 ************************************** ** *** ** * ****** Acc414 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc420 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc761 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc504 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc563 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc757 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc848 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Tsuyuake_Pikm CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Kusabue_Pik CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Kanto51_Pik CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 K60_Pikp CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc108 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc130 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc719 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc729 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc710 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc709 CACAGTCATGGCCACCGGATGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAT 240 Acc220 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Nipponbare CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Acc224 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 AccUP3 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 AccUP1 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Acc206 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Acc201 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Acc724 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAT 240 Acc415 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Acc417 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Acc435 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAC 240 Acc712 CACAACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACGTCGCCTATGAT 240 Acc101 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 Acc715 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 Acc706 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 Acc624 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 Acc1 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 Acc440 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 Acc868 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 Acc718 CACTACCATGACAACCGGAGGAAGGACTGGATGAAGCAGATCCGAGACATCGCCTATGAC 240 *** **** * ****** **************************** ********** Ashikawa et al. Supplementary Fig. S2 (2/28)

3 Acc414 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc420 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc761 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc504 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc563 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc757 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc848 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Tsuyuake_Pikm GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Kusabue_Pik GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Kanto51_Pik GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 K60_Pikp GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc108 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc130 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc719 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc729 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc710 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc709 GTTGAGGACTGTATCGATGACTTTGCCCACCGCCTCCCTCAGGATTCCATCAGCGATGCC 300 Acc220 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Nipponbare GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc224 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 AccUP3 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 AccUP1 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc206 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc201 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc724 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc415 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc417 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc435 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc712 GTTGAGGACTGCATCGATGACTTTGCGCACCGGCTCCCCCAGGATTCAATCAGCGATGCC 300 Acc101 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGACTCAATCAGCGACGCC 300 Acc715 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGACTCAATCAGCGACGCC 300 Acc706 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGACTCAATCAGCGACGCC 300 Acc624 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGACTCAATCAGCGACGCC 300 Acc1 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGATTCAATCAGCGACGCC 300 Acc440 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGATTCAATCAGCGACGCC 300 Acc868 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGATTCAATCAGCGACGCC 300 Acc718 GTTGAGGACTGCATCGATGACTTTGCCCACCGGCTCCCCCAGGATTCAATCAGCGACGCC 300 *********** ************** ***** ***** ***** ** ******** *** Acc414 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc420 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc761 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc504 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc563 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc757 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc848 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Tsuyuake_Pikm AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Kusabue_Pik AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Kanto51_Pik AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 K60_Pikp AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc108 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc130 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc719 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc729 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc710 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc709 AAATGGTCCTTCCTACTCACAAAAATCTATGAACTATGGACATGGTGGCCACGTCGTGTG 360 Acc220 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Nipponbare AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc224 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 AccUP3 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 AccUP1 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc206 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc201 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc724 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc415 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc417 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc435 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc712 AAATGCTCCTTCATACTCACAAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGCGAT 360 Acc101 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 Acc715 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 Acc706 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 Acc624 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 Acc1 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 Acc440 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 Acc868 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 Acc718 AAATGCTCCTTCCTAGTCACGAAAATGTATGAACTCTTGACATGGTGGCCTCGTCGTGAT 360 ***** ****** ** **** ***** ******** * ************ ***** * Ashikawa et al. Supplementary Fig. S2 (3/28)

4 Acc414 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc420 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc761 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc504 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc563 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc757 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc848 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Tsuyuake_Pikm ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Kusabue_Pik ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Kanto51_Pik ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 K60_Pikp ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc108 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc130 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc719 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc729 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc710 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc709 ATTGCTTCCAACATTGCCCAACTCAAGGTACGGGCACAACAGATCG-------------- 406 Acc220 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Nipponbare ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc224 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 AccUP3 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 AccUP1 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc206 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc201 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc724 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc415 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc417 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc435 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc712 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc101 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc715 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc706 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc624 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc1 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc440 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 Acc868 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCGGGCGCAACAGATCG 420 Acc718 ATTGCTTCGAGAATTGCTGAACTCAAGGTACGGGCGCAACAGATCG-------------- 406 ******** * ***** **************** ********** Acc414 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc420 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc761 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc504 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc563 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc757 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc848 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Tsuyuake_Pikm CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Kusabue_Pik CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Kanto51_Pik CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 K60_Pikp CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc108 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc130 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc719 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc729 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc710 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc709 CAGATCGACGTAGTAGATACGGAGTGAACAACCCAGAAC---ACCTTGACAGTAGCAGCA 463 Acc220 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Nipponbare CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc224 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 AccUP3 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 AccUP1 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc206 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc201 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc724 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc415 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc417 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc435 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc712 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAAC---ACTGTGACAGCAGCAACA 463 Acc101 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 466 Acc715 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 466 Acc706 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 466 Acc624 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 466 Acc1 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 466 Acc440 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 466 Acc868 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 480 Acc718 CGGATCGGCGCAACAGATATGGAGTGAACAACCCAGAACTGCACTGTGACAGCAGCAACA 466 * ***** ** * ***** ******************* ** ****** **** ** Ashikawa et al. Supplementary Fig. S2 (4/28)

5 Acc414 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc420 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc761 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc504 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc563 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc757 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc848 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Tsuyuake_Pikm GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Kusabue_Pik GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Kanto51_Pik GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 K60_Pikp GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc108 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc130 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc719 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc729 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc710 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc709 GT------GCCAGGACCCGTGCTGTCAATTACGAAATTGCTGAGTATCAGGTCACAAGCC 517 Acc220 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Nipponbare GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc224 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 AccUP3 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 AccUP1 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc206 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc201 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc724 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc415 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc417 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc435 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc712 GTCCCAGACCCAGAGCCCATGCTGCGGCTCAAGACATTGCTGAGTATCAGGACACAAAAC 523 Acc101 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 520 Acc715 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 520 Acc706 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 520 Acc624 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 520 Acc1 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 520 Acc440 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 520 Acc868 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 534 Acc718 G------GCCCAGAGCCCGTTCTGCGGCTCAAGACATTGCTGAGTATCAGGTCACAAAAC 520 * **** *** * *** * * ** **************** ***** * Acc414 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc420 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc761 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc504 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc563 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc757 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc848 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Tsuyuake_Pikm CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Kusabue_Pik CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Kanto51_Pik CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 K60_Pikp CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc108 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc130 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc719 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc729 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc710 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc709 CTCAGATCATTGGTATAAAGGAGCCTGTGGGGATGAAGACGGTCATGGAGGAGCTTGAGG 577 Acc220 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Nipponbare CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc224 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 AccUP3 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 AccUP1 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc206 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc201 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc724 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc415 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc417 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc435 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc712 CTCAGATCGTCAGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAAACCTTGAGA 583 Acc101 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 580 Acc715 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 580 Acc706 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 580 Acc624 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 580 Acc1 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 580 Acc440 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 580 Acc868 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 594 Acc718 TTCAGATCATCGGTATAAAGGAGCCTGTGGGGATGAAGACTGTCATGGAAGACCTTGAGA 580 ******* * **************************** ******** * ****** Ashikawa et al. Supplementary Fig. S2 (5/28)

6 Acc414 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc420 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc761 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc504 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc563 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc757 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc848 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Tsuyuake_Pikm TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Kusabue_Pik TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Kanto51_Pik TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 K60_Pikp TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc108 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc130 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc719 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc729 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc710 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc709 TTTGGTTAACTAATCCTCAAGCTGAAAATGGGCAAGCTGTTCTGTCCATAGTCGGTTTTG 637 Acc220 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Nipponbare AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc224 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 AccUP3 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 AccUP1 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc206 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc201 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc724 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc415 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc417 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc435 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc712 AGTGGCTAACCGAACCTCAACCTGATAAGGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 643 Acc101 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 640 Acc715 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 640 Acc706 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 640 Acc624 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 640 Acc1 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 640 Acc440 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 640 Acc868 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 654 Acc718 AGTGGTTAACCGAACCTCAACCTGATAACGGGCGAGCTGTTCTGTCCATTGTCGGTTTCG 640 *** **** * ****** **** ** **** *************** ******** * Acc414 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc420 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc761 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc504 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGAAAAATTTC 697 Acc563 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGAAAAATTTC 697 Acc757 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGAAAAATTTC 697 Acc848 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGAAAAATTTC 697 Tsuyuake_Pikm GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGAAAAATTTC 697 Kusabue_Pik GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGAAAAATTTC 697 Kanto51_Pik GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGAAAAATTTC 697 K60_Pikp GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc108 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc130 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc719 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc729 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc710 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc709 GAGGTGTGGGAAAGACTACCATTGCCACAGCATTGTACAGAAAAGTCAGTGATAAATTTC 697 Acc220 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Nipponbare GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc224 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 AccUP3 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 AccUP1 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc206 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc201 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc724 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc415 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc417 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc435 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc712 GTGGTGTGGGGAAGACCACCATTGCCATGGCATTGTACAGAAAAGTCAGTGGTAAATTTG 703 Acc101 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 700 Acc715 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 700 Acc706 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 700 Acc624 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 700 Acc1 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 700 Acc440 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 700 Acc868 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 714 Acc718 GTGGTGTGGGGAAGACCACCATTGCCATGGCTTTGTACAGAAAAGTCAGTGGTAAATTTG 700 * ******** ***** ********** ** ******************* ****** Ashikawa et al. Supplementary Fig. S2 (6/28)

7 Acc414 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc420 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc761 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc504 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc563 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc757 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc848 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Tsuyuake_Pikm AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Kusabue_Pik AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Kanto51_Pik AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 K60_Pikp AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc108 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc130 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc719 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc729 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc710 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc709 AGTGCCGGGCATCAGTAGCTGTGTCTCAGAACTATGACCAAGGCAAAGTCCTCAATAGTA 757 Acc220 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Nipponbare ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc224 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 AccUP3 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 AccUP1 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc206 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc201 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc724 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc415 ACTGCCAGGCGTCAGTCGGCGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc417 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc435 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc712 ACTGCCAGGCGTCAGTCGCTGTGTCTCAGAACTATGATGAAGACGAAGTCCTCAGGAGTA 763 Acc101 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 760 Acc715 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 760 Acc706 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 760 Acc624 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 760 Acc1 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 760 Acc440 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 760 Acc868 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 774 Acc718 GCTGCCGGGCGTCAGTAGCTGTGTCTCAGAACTATGACCAAGATGCAGTCCTCAGGAGTA 760 **** *** ***** * ***************** *** ******** **** Acc414 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc420 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc761 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc504 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc563 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc757 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc848 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Tsuyuake_Pikm TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Kusabue_Pik TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Kanto51_Pik TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 K60_Pikp TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc108 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc130 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc719 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc729 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc710 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc709 TTCTGAGTCAAGTCAGCAATCAGGAGCAGG---GCAGCAGCACAACAATTAGT----GAG 810 Acc220 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Nipponbare TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc224 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 AccUP3 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 AccUP1 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc206 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc201 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc724 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc415 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc417 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc435 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc712 TTCTGAATCAAGTCAGCAAACAGGAGGAGGCCGGTGGCAGCACAGAAAGTAGTAGTAGAG 823 Acc101 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 817 Acc715 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 817 Acc706 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 817 Acc624 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 817 Acc1 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 817 Acc440 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 817 Acc868 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 831 Acc718 TTCTGAATCAAGTCAGCAACCAGGAGGAGGCCGGTAGCAGCACAGAAAGTAGT---AGAG 817 ****** ************ ****** *** * ******** ** **** *** Ashikawa et al. Supplementary Fig. S2 (7/28)

8 Acc414 A-----------------------------------------------AAAAGAACCTCA 823 Acc420 A-----------------------------------------------AAAAGAACCTCA 823 Acc761 A-----------------------------------------------AAAAGAACCTCA 823 Acc504 A-----------------------------------------------AAAAGAACCTCA 823 Acc563 A-----------------------------------------------AAAAGAACCTCA 823 Acc757 A-----------------------------------------------AAAAGAACCTCA 823 Acc848 A-----------------------------------------------AAAAGAACCTCA 823 Tsuyuake_Pikm A-----------------------------------------------AAAAGAACCTCA 823 Kusabue_Pik A-----------------------------------------------AAAAGAACCTCA 823 Kanto51_Pik A-----------------------------------------------AAAAGAACCTCA 823 K60_Pikp A-----------------------------------------------AAAAGAACCTCA 823 Acc108 A-----------------------------------------------AAAAGAACCTCA 823 Acc130 A-----------------------------------------------AAAAGAACCTCA 823 Acc719 A-----------------------------------------------AAAAGAACCTCA 823 Acc729 A-----------------------------------------------AAAAGAACCTCA 823 Acc710 A-----------------------------------------------AAAAGAACCTCA 823 Acc709 A-----------------------------------------------AAAAGAACCTCA 823 Acc220 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Nipponbare ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc224 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 AccUP3 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 AccUP1 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc206 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc201 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc724 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc415 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc417 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc435 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc712 ATGAGAACACCAGGGAACCCCAGGGCAGCAGTAGCACATCAAGTAGAGAGGAGAACACTG 883 Acc101 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 847 Acc715 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 847 Acc706 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 847 Acc624 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 847 Acc1 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 847 Acc440 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 847 Acc868 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 861 Acc718 AT------------------------------ACCACAGCAAGTAGAGAGGAGAACACTG 847 * * ***** Acc414 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc420 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc761 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc504 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc563 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc757 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc848 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Tsuyuake_Pikm CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Kusabue_Pik CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Kanto51_Pik CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 K60_Pikp CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc108 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc130 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc719 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc729 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc710 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc709 CC---TCAGGCGCTAAGAGCATGTT---------GAAGACAGCCCTGTCACTGCTCAGAG 871 Acc220 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Nipponbare CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc224 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 AccUP3 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 AccUP1 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc206 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc201 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc724 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc415 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc417 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc435 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc712 CCGAGTCAGGCACTAAAAGGATGTTGAACAAGTTGAAGAAAGCCCTACCACTGTC----- 938 Acc101 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 902 Acc715 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 902 Acc706 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 902 Acc624 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 902 Acc1 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 902 Acc440 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 902 Acc868 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 916 Acc718 CTGAGCCAGGCACTAAAAGCACGTTTATCAAATTGAAGAAAGCCCCATCACTGTC----- 902 * ***** **** ** * *** ***** ***** ***** Ashikawa et al. Supplementary Fig. S2 (8/28)

9 Acc414 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc420 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc761 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc504 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc563 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc757 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc848 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Tsuyuake_Pikm GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Kusabue_Pik GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Kanto51_Pik GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 K60_Pikp GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc108 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc130 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc719 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc729 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc710 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc709 GTAATTGTATATGTCAGCCAGAAAATGATGGAAACCCTGATAATACACCAATCAGGCTGC 931 Acc220 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Nipponbare ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc224 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 AccUP3 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 AccUP1 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc206 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc201 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc724 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc415 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc417 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc435 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc712 ---ACTAC-----TCGG--AGGGAATGATG---------ATAAGACATCGGTCAGGCAGC 979 Acc101 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 943 Acc715 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 943 Acc706 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 943 Acc624 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 943 Acc1 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 943 Acc440 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 943 Acc868 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 957 Acc718 ---ACTGC-----TCGG--AAGAAATGATG---------ATAAGACACCGGTCAGCCAGC 943 * * ** * * ******* **** *** * **** * ** Acc414 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc420 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc761 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc504 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc563 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc757 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc848 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Tsuyuake_Pikm AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Kusabue_Pik AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Kanto51_Pik AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 K60_Pikp AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc108 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc130 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc719 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc729 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc710 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc709 AGGAAACAACGGACGATGATCAAAACCCCAGAAAACTGGAACAGCTCCTGGCCGAAAAGA 991 Acc220 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Nipponbare AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc224 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 AccUP3 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 AccUP1 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc206 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc201 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc724 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc415 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc417 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc435 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc712 AGGAAACAATGGGCTCTCTTCAGCTCCGCGAAGAACTGAAACGGCGCCTGGCCGAAAAGA 1039 Acc101 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1003 Acc715 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1003 Acc706 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1003 Acc624 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1003 Acc1 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1003 Acc440 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1003 Acc868 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1017 Acc718 AGGAAACAATGGGCTATGTTCAGCTTCGCCAAGAACTGAAACGGCGCCTGGGCGAAAAGA 1003 ********* ** * * *** * * * ***** *** ** ***** ******** Ashikawa et al. Supplementary Fig. S2 (9/28)

10 Acc414 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc420 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc761 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc504 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc563 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc757 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc848 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Tsuyuake_Pikm GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Kusabue_Pik GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Kanto51_Pik GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 K60_Pikp GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc108 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc130 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc719 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc729 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc710 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc709 GTTATATCCTCTTGATTGATGACATTTGGTCTGCCGAAACATGGGAGAGTAT---CAGAT 1048 Acc220 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Nipponbare GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc224 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 AccUP3 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 AccUP1 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc206 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc201 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc724 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc415 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc417 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc435 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc712 GATATATCCTCTTGATTGATGATATTTGGTCTGCCAAGACATGGAACAGTATCATCATAC 1099 Acc101 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1063 Acc715 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1063 Acc706 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1063 Acc624 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1063 Acc1 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1063 Acc440 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1063 Acc868 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1077 Acc718 GATATATCCTCTTGATTGATGACATTTGGTCTGCCAAGACATGGTTGGATGTCGTCATAC 1063 * ******************** ************ * ****** * * ** * Acc414 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc420 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc761 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc504 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc563 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc757 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc848 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Tsuyuake_Pikm CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Kusabue_Pik CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Kanto51_Pik CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 K60_Pikp CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc108 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc130 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc719 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc729 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc710 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc709 CGATTTTGCC---TAAAAATAATAAAGGCGGTAGAATAATAGTGACTACAAGATTTCAAG 1105 Acc220 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Nipponbare CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc224 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 AccUP3 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 AccUP1 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc206 CGTTTCTGCCTTCTGAAAATGATAAACACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc201 CGTTTCTGCCTTCTGAAAATGATAAACACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc724 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc415 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc417 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc435 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc712 CGTTTCTGCCTTCTGAAAATGATAAAGACAGCAGAATAATAGTGACTACAAGATTTCATG 1159 Acc101 CGTTTTTGCCGGATGAAGCTAATAACAACAGCAGAATAATAGTGACTACAAGATTTCATG 1123 Acc715 CGTTTTTGCCGGATGAAGCTAATAACAACAGCAGAATAATAGTGACTACAAGATTTCATG 1123 Acc706 CGTTTTTGCCGGATGAAGCTAATAACAACAGCAGAATAATAGTGACTACAAGATTTCATG 1123 Acc624 CGTTTTTGCCGGATGAAGCTAATAACAACAGCAGAATAATAGTGACTACAAGATTTCATG 1123 Acc1 CGTTTTTGCCGGATGAAGCTAATAACAACAGCAGAATAATAGTGACTACAAGATTTCATG 1123 Acc440 CGTTTTTGCCGGATGAAGATAATAACAGCAGCAGAATAATAGTGACTACAAGATTTCATG 1123 Acc868 CGTTTTTGCCGGATGAAGATAATAACAGCAGCAGAATAATAGTGACTACAAGATTTCATG 1137 Acc718 CGTTTTTGCCGGATGAAGATAATAACAGCAGCAGAATAATAGTGACTACAAGATTTCATG 1123 ** ** **** * ** * **** * * ************************** * Ashikawa et al. Supplementary Fig. S2 (10/28)

11 Acc414 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc420 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc761 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc504 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc563 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc757 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc848 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Tsuyuake_Pikm CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Kusabue_Pik CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Kanto51_Pik CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 K60_Pikp CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc108 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc130 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc719 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc729 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc710 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc709 CTGTTGGTTCAACATGCTCCCCT------------------------------------C 1129 Acc220 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Nipponbare CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc224 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 AccUP3 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 AccUP1 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc206 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc201 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc724 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc415 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc417 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc435 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc712 CTGTTGGTTCCACATGCTCCCCTAGACATAAAAATGATGAGGCCACATCCTCCCCTGGAC 1219 Acc101 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1183 Acc715 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1183 Acc706 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1183 Acc624 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1183 Acc1 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1183 Acc440 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1183 Acc868 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1197 Acc718 CTGTTGGTTCCACATGCTCCCCTGGACATAAAAATGTTGAGGCCACATCCTCCCCTAGAC 1183 ********** ************ * Acc414 TTGAAACT---------------------------------------------------G 1138 Acc420 TTGAAACT---------------------------------------------------G 1138 Acc761 TTGAAACT---------------------------------------------------G 1138 Acc504 TTGAAACT---------------------------------------------------G 1138 Acc563 TTGAAACT---------------------------------------------------G 1138 Acc757 TTGAAACT---------------------------------------------------G 1138 Acc848 TTGAAACT---------------------------------------------------G 1138 Tsuyuake_Pikm TTGAAACT---------------------------------------------------G 1138 Kusabue_Pik TTGAAACT---------------------------------------------------G 1138 Kanto51_Pik TTGAAACT---------------------------------------------------G 1138 K60_Pikp TTGAAACT---------------------------------------------------G 1138 Acc108 TTGAAACT---------------------------------------------------G 1138 Acc130 TTGAAACT---------------------------------------------------G 1138 Acc719 TTGAAACT---------------------------------------------------G 1138 Acc729 TTGAAACT---------------------------------------------------G 1138 Acc710 TTGAAACT---------------------------------------------------G 1138 Acc709 TTGAAACT---------------------------------------------------G 1138 Acc220 ATGGAAAG---------------------------------------------------G 1228 Nipponbare ATGGAAAG---------------------------------------------------G 1228 Acc224 ATGGAAAG---------------------------------------------------G 1228 AccUP3 ATGGAAAG---------------------------------------------------G 1228 AccUP1 ATGGAAAG---------------------------------------------------G 1228 Acc206 ATGGAAAG---------------------------------------------------G 1228 Acc201 ATGGAAAG---------------------------------------------------G 1228 Acc724 ATGGAAAG---------------------------------------------------G 1228 Acc415 ATGGAAAG---------------------------------------------------G 1228 Acc417 ATGGAAAG---------------------------------------------------G 1228 Acc435 ATGGAAAG---------------------------------------------------G 1228 Acc712 ATGGAAAG---------------------------------------------------G 1228 Acc101 CTGGAAATGATCGTGTGCATAAAAATGTTGAGGCCACATCCTCCCCTAGACCTGGAAATA 1243 Acc715 CTGGAAATGATCGTGTGCATAAAAATGTTGAGGCCACATCCTCCCCTAGACCTGGAAATA 1243 Acc706 CTGGAAATGATCGTGTGCATAAAAATGTTGAGGCCACATCCTCCCCTAGACCTGGAAATA 1243 Acc624 CTGGAAATGATCGTGTGCATAAAAATGTTGAGGCCACATCCTCCCCTAGACCTGGAAATA 1243 Acc1 CTGGAAAT---------------------------------------------------A 1192 Acc440 CTGGAAAT---------------------------------------------------G 1192 Acc868 CTGGAAAT---------------------------------------------------G 1206 Acc718 CTGGAAAT---------------------------------------------------G 1192 ** ** Ashikawa et al. Supplementary Fig. S2 (11/28)

12 Acc414 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc420 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc761 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc504 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc563 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc757 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc848 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Tsuyuake_Pikm ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Kusabue_Pik ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Kanto51_Pik ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 K60_Pikp ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc108 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc130 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc719 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc729 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc710 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc709 ATCGTTTGCATACAGTTGATTTTCTCACCGATGACGAGTCCCAAAACTTATTCAATACAA 1198 Acc220 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Nipponbare ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc224 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 AccUP3 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 AccUP1 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc206 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc201 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc724 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc415 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc417 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc435 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc712 ATCTTTTGCATAAAGTTGATTTTCTCACAGGTGACAAGCCCCTAGATTTATTTAATGCAA 1288 Acc101 ATCGTGTGCATACTGTTGATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1303 Acc715 ATCGTGTGCATACTGTTGATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1303 Acc706 ATCGTGTGCATACTGTTGATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1303 Acc624 ATCGTGTGCATACTGTTGATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1303 Acc1 ATCGTGTGCATACTGTTGATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1252 Acc440 ATCTTGTGCATACTGTTCATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1252 Acc868 ATCTTGTGCATACTGTTCATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1266 Acc718 ATCTTGTGCATACTGTTCATTTTCTCAGCGATGACGAGTCCCAAAACTTATTTAATGCAA 1252 *** * ****** *** ********* * **** ** *** * * ***** *** *** Acc414 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc420 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc761 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc504 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc563 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc757 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc848 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Tsuyuake_Pikm GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Kusabue_Pik GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Kanto51_Pik GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 K60_Pikp GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc108 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc130 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc719 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc729 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc710 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc709 GTATTTGTGAATCAAAGATAAGAAAAGATAGCAACAAAGTAGACGAGCAAGTCCCTGAGG 1258 Acc220 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------GA 1327 Nipponbare GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------GA 1327 Acc224 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------GA 1327 AccUP3 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------GA 1327 AccUP1 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------GA 1327 Acc206 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------CA 1327 Acc201 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------CA 1327 Acc724 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------GA 1327 Acc415 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------CA 1327 Acc417 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------CA 1327 Acc435 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------CA 1327 Acc712 GCATTCCTGACCCAATGAAAAGAACAGATAGAGACAA---------------------CA 1327 Acc101 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1342 Acc715 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1342 Acc706 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1342 Acc624 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1342 Acc1 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1291 Acc440 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1291 Acc868 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1305 Acc718 GCATTCCTGATTCAATGAAAAGTGCAGATAGAGACAA---------------------GG 1291 * *** *** *** ** *** ****** **** Ashikawa et al. Supplementary Fig. S2 (12/28)

13 Acc414 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc420 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc761 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc504 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCAGCATGGCTGGTCTTGTCG 1318 Acc563 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCAGCATGGCTGGTCTTGTCG 1318 Acc757 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCAGCATGGCTGGTCTTGTCG 1318 Acc848 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCAGCATGGCTGGTCTTGTCG 1318 Tsuyuake_Pikm AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCAGCATGGCTGGTCTTGTCG 1318 Kusabue_Pik AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCAGCATGGCTGGTCTTGTCG 1318 Kanto51_Pik AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCAGCATGGCTGGTCTTGTCG 1318 K60_Pikp AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc108 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc130 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc719 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc729 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc710 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc709 AAATATGGAAAATATGTGGGGGATTGCCTTTGGCCATAGTCACCATGGCTGGTCTTGTCG 1318 Acc220 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Nipponbare AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc224 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 AccUP3 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 AccUP1 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc206 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc201 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc724 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc415 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc417 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc435 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc712 AGTTATCAAAGATATGTGGGGGATTGCCTTTGGCCATTGTCACCATGGCTGGTCTTGTAG 1387 Acc101 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1402 Acc715 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1402 Acc706 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1402 Acc624 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1402 Acc1 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1351 Acc440 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1351 Acc868 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1365 Acc718 AGTTATCGAGCATATGTGGGGGATTACCTTTGACCATTGTCACCATGGCTGGTCTTGTCG 1351 * *** * ************** ****** **** **** *************** * Acc414 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc420 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc761 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc504 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc563 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc757 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc848 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Tsuyuake_Pikm CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Kusabue_Pik CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Kanto51_Pik CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 K60_Pikp CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc108 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc130 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc719 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc729 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc710 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc709 CCTGCAACCCAAGGAAAGCCTGCTGCGATTGGAGTAAACTTTGCAAATCATTATTTCCAG 1378 Acc220 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Nipponbare CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc224 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 AccUP3 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 AccUP1 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc206 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc201 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc724 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc415 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc417 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc435 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc712 CCTGCAACCCAAACAAAGCCAACTCCGATTGGAGTAAACTTTGCGAATCATTATTTCCAT 1447 Acc101 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCGAATCATTATTTCCAG 1462 Acc715 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCGAATCATTATTTCCAG 1462 Acc706 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCGAATCATTATTTCCAG 1462 Acc624 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCGAATCATTATTTCCAG 1462 Acc1 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCGAATCATTATTTCCAG 1411 Acc440 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCAAATCATTATTTCCAG 1411 Acc868 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCAAATCATTATTTCCAG 1425 Acc718 CCTGCAACCCAAACAAGACCGACTGCGATTGGCGTAAACTTTGCAAATCATTATTTCCAG 1411 ************ ** ** ** ******* *********** ************** Ashikawa et al. Supplementary Fig. S2 (13/28)

14 Acc414 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc420 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc761 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc504 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc563 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc757 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc848 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Tsuyuake_Pikm AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Kusabue_Pik AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Kanto51_Pik AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 K60_Pikp AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc108 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc130 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc719 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc729 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc710 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc709 AGCAAGAAACTCCTCTTACCCTCGATGGTGTTACAAGGATACTGGATTGTTGTTACAATG 1438 Acc220 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Nipponbare ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc224 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 AccUP3 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 AccUP1 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc206 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc201 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc724 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc415 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc417 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc435 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc712 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1507 Acc101 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1522 Acc715 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1522 Acc706 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1522 Acc624 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1522 Acc1 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1471 Acc440 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1471 Acc868 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1485 Acc718 ATCCAGTAACTACTCTTAACCTGGATGGGGTTACGAGGATACTGGATTGTTGTTACAATG 1471 * * ** **** ****** *** ***** ***** ************************* Acc414 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc420 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc761 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc504 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc563 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc757 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc848 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Tsuyuake_Pikm ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Kusabue_Pik ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Kanto51_Pik ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 K60_Pikp ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc108 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc130 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc719 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc729 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc710 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc709 ATTTGCCTGCGGATCTGAAGACTTGCTTATTGTACTTGAGTATATTTCCGAAGGGTTGGA 1498 Acc220 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Nipponbare ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc224 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 AccUP3 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 AccUP1 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc206 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc201 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc724 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc415 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc417 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc435 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc712 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1567 Acc101 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1582 Acc715 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1582 Acc706 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1582 Acc624 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1582 Acc1 ATTTGCCTGCAGATCTCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1531 Acc440 ATTTGCCTGCAGATATCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1531 Acc868 ATTTGCCTGCAGATATCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1545 Acc718 ATTTGCCTGCAGATATCAAGACCTGCTTATTGTACTTGAGTATATTTCCAAAGGGTTGGA 1531 ********** *** * ***** ************************** ********** Ashikawa et al. Supplementary Fig. S2 (14/28)

15 Acc414 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc420 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc761 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc504 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc563 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc757 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc848 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Tsuyuake_Pikm AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Kusabue_Pik AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Kanto51_Pik AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 K60_Pikp AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc108 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc130 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc719 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc729 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc710 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc709 AAATTAGTAGGAAACGTTTGTCCCGGCGATGGATAGCTGAAGGTTTTGCTAATGAGAAGC 1558 Acc220 AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Nipponbare AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc224 AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 AccUP3 AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 AccUP1 AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc206 AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc201 AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc724 AAATTAGTAGGAAGCGGTTGGCCCGACGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc415 AAATTAGTAGGAAGCGGTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc417 AAATTAGTAGGAAGCGGTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc435 AAATTAGTAGGAAGCGGTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc712 AAATTAGTAGGAAGCGGTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1627 Acc101 AAATTAGTAGGAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1642 Acc715 AAATTAGTAGGAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1642 Acc706 AAATTAGTAGGAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1642 Acc624 AAATTAGTAGGAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1642 Acc1 AAATTAGTAGGAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1591 Acc440 AAATTAGTAGAAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1591 Acc868 AAATTAGTAGAAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1605 Acc718 AAATTAGTAGAAAGCGTTTGGCCCGGCGATGGATTGCTGAAGGTTTTGCTACTGAGAAGC 1591 ********** ** ** *** **** ******** **************** ******** Acc414 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc420 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc761 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc504 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc563 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc757 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc848 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Tsuyuake_Pikm AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Kusabue_Pik AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Kanto51_Pik AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 K60_Pikp AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc108 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc130 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc719 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc729 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc710 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc709 AAGGGTTAACCCAGGAAAGAGTTGCAGAGGCATACTTTAATCAACTCACAAGAAGGAACT 1618 Acc220 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Nipponbare AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc224 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 AccUP3 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 AccUP1 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc206 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc201 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc724 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc415 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc417 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc435 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc712 AAGGGCTAACCGAAGAGGAAGTTGCAGAGGCATACTTTAATCAGCTCGCAAGAAGGAACT 1687 Acc101 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1702 Acc715 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1702 Acc706 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1702 Acc624 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1702 Acc1 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1651 Acc440 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1651 Acc868 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1665 Acc718 AAGGGCTAACCGAGGAGGAAGTTGCAGAGACATACTTTAATCAGCTCACAAGAAGGAACT 1651 ***** ***** * ** ********** ************* *** ************ Ashikawa et al. Supplementary Fig. S2 (15/28)

16 Acc414 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc420 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc761 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc504 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc563 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc757 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc848 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Tsuyuake_Pikm TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Kusabue_Pik TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Kanto51_Pik TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 K60_Pikp TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc108 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc130 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc719 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc729 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc710 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc709 TAGTACGTCCCATGGAGCATGGCAGCAATGGGAAGGTAAAAACGTTTCAAGTTCATGACA 1678 Acc220 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Nipponbare TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc224 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 AccUP3 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 AccUP1 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc206 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc201 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc724 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc415 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc417 TAATACACCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc435 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc712 TAATACGCCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1747 Acc101 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAATCCTTTCAAGTTCATGACA 1762 Acc715 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAATCCTTTCAAGTTCATGACA 1762 Acc706 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAATCCTTTCAAGTTCATGACA 1762 Acc624 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAATCCTTTCAAGTTCATGACA 1762 Acc1 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1711 Acc440 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1711 Acc868 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1725 Acc718 TAATACGTCCTGTGGAGCATGGCAGCAATGGGAAGGTAAAAGCCTTTCAAGTTCATGACA 1711 ** *** ** ***************************** * **************** Acc414 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc420 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc761 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc504 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc563 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc757 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc848 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Tsuyuake_Pikm TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Kusabue_Pik TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Kanto51_Pik TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 K60_Pikp TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc108 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc130 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc719 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc729 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc710 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc709 TGGTTCTTGAATACATCATGTCCAAATCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1738 Acc220 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Nipponbare TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc224 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 AccUP3 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 AccUP1 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc206 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc201 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc724 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc415 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc417 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc435 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc712 TGGTTCTTGAATACATCATGTCGAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1807 Acc101 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1822 Acc715 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1822 Acc706 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1822 Acc624 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1822 Acc1 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1771 Acc440 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1771 Acc868 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1785 Acc718 TGGTTCTTGAATACATCATGTCCAAGTCAATCGAAGAGAATTTTATTACTGTGGTTGGTG 1771 ********************** ** ********************************** Ashikawa et al. Supplementary Fig. S2 (16/28)

17 Acc414 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc420 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc761 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc504 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc563 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc757 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc848 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Tsuyuake_Pikm GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Kusabue_Pik GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Kanto51_Pik GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 K60_Pikp GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc108 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc130 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc719 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc729 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc710 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc709 GACACTGGCAGATGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1798 Acc220 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Nipponbare GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc224 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 AccUP3 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 AccUP1 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc206 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc201 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc724 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc415 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc417 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc435 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc712 GACACTGGCAGATGACTGCGCCAAGCAATAAAGTCCGTCGACTATCGTTGCAAAGCAGTG 1867 Acc101 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1882 Acc715 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1882 Acc706 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1882 Acc624 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1882 Acc1 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1831 Acc440 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1831 Acc868 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1845 Acc718 GACAGTGGCAGGTGACTGCACCAAGCAATAAAGTCCGTCGACTGTCGATGCAAAGCAGTG 1831 **** ****** ******* *********************** *** ************ Acc414 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc420 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc761 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc504 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc563 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc757 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc848 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Tsuyuake_Pikm GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Kusabue_Pik GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Kanto51_Pik GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 K60_Pikp GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc108 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc130 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc719 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc729 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc710 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc709 GATCCAATCGTGGAAGTTCAACAAAAGGCCTGAACTTGGCTCAAGTGAGATCACTGACGG 1858 Acc220 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Nipponbare GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc224 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 AccUP3 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 AccUP1 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc206 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc201 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc724 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc415 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc417 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc435 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc712 GATCCAAGCATGGAAATTCTACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACGG 1927 Acc101 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1942 Acc715 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1942 Acc706 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1942 Acc624 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1942 Acc1 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1891 Acc440 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1891 Acc868 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1905 Acc718 GATCCAAGAATGGAAATTCAACAAAAGGCCTGAACTTGGCTCAAGTGCGATCACTGACAG 1891 ******* ***** *** *************************** ********** * Ashikawa et al. Supplementary Fig. S2 (17/28)

18 Acc414 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc420 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc761 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc504 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc563 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc757 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc848 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Tsuyuake_Pikm TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Kusabue_Pik TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Kanto51_Pik TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 K60_Pikp TGTTTGGGAACCTGAACCATATGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc108 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc130 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc719 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc729 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc710 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc709 TGTTTGGGAACCTGAACCATGTGCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1918 Acc220 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Nipponbare TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc224 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 AccUP3 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 AccUP1 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc206 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc201 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc724 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc415 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc417 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc435 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc712 TGTTTGGGAACCTGAACCATGTTCCATTCCATTCATTCAACTATGGGATAATACAGGTGC 1987 Acc101 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 2002 Acc715 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 2002 Acc706 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 2002 Acc624 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 2002 Acc1 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 1951 Acc440 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 1951 Acc868 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 1965 Acc718 TGTTTGGGAACCTGAACCATGTGCCATTCCGTTCATTCAACTATGGGATAATACATGTGC 1951 ******************** * ******* ************************ **** Acc414 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc420 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc761 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc504 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc563 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc757 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc848 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Tsuyuake_Pikm TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Kusabue_Pik TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Kanto51_Pik TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 K60_Pikp TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc108 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc130 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc719 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc729 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc710 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc709 TGGATCTTGAGGACTGGAAGGGTTTGAAAGAGAGACATATGACGGAGATATGTCAAATGC 1978 Acc220 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Nipponbare TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc224 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 AccUP3 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 AccUP1 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc206 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc201 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc724 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc415 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc417 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc435 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc712 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGAGAGACATGTGACGGAGATATGTCAAATGC 2047 Acc101 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2062 Acc715 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2062 Acc706 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2062 Acc624 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2062 Acc1 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2011 Acc440 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2011 Acc868 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2025 Acc718 TGGATCTTGAGGGTTGGAAGGGTTTGAAAGGGAGACATATGAAAGAGATATGCCAAATGC 2011 ************ **************** ******* *** ******** ******* Ashikawa et al. Supplementary Fig. S2 (18/28)

19 Acc414 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc420 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc761 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc504 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc563 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc757 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc848 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Tsuyuake_Pikm TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Kusabue_Pik TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Kanto51_Pik TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 K60_Pikp TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc108 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc130 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc719 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc729 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc710 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc709 TTTTACTCAAGTATTTGAGCATCCGACGAACAGAAATTTCCAAAATTCCCTCCAAGATTC 2038 Acc220 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Nipponbare TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc224 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 AccUP3 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 AccUP1 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc206 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc201 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc724 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc415 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc417 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc435 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc712 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCAAAGATTG 2107 Acc101 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2122 Acc715 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2122 Acc706 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2122 Acc624 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2122 Acc1 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2071 Acc440 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2071 Acc868 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2085 Acc718 TTGTACTCAAGTATTTGAGCATCCGGCGGACAGAAATTGCCAAAATTCCCTCCAAGATCG 2071 ** ********************** ** ********* ************* ***** Acc414 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc420 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc761 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc504 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc563 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc757 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc848 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Tsuyuake_Pikm AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Kusabue_Pik AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Kanto51_Pik AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 K60_Pikp AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc108 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc130 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc719 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc729 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc710 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc709 AGAAACTTGAGTACTTGGAAACTCTTGACATAAGGGAGACATATGTCAGGGACCTGCCTA 2098 Acc220 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Nipponbare AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc224 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 AccUP3 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 AccUP1 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc206 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc201 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc724 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc415 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc417 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc435 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc712 AGAAACTTGAGTATTTGGAAACTCTTGACATAAGGGAGACATATGTCGAGGAGCTGCCTA 2167 Acc101 AGAAACTCGAGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2182 Acc715 AGAAACTCGAGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2182 Acc706 AGAAACTCGAGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2182 Acc624 AGAAACTCGAGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2182 Acc1 AGAAACTCGAGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2131 Acc440 AGAAACTCGAGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2131 Acc868 AGAAACTCGAGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2145 Acc718 AGAAACTCGTGTATTTGGAAACTCTTGACATAAGGGAGACAAACGTCAAGGAGCTGCCTA 2131 ******* * *** *************************** * *** *** ******* Ashikawa et al. Supplementary Fig. S2 (19/28)

20 Acc414 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc420 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc761 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc504 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc563 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc757 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc848 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Tsuyuake_Pikm AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Kusabue_Pik AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Kanto51_Pik AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 K60_Pikp AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc108 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc130 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc719 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc729 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc710 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc709 AGTCAATAGTCCAGCTAAAACGGATCATTAGCATACTTGGAGGGAATAAAAACACACGGA 2158 Acc220 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Nipponbare AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc224 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 AccUP3 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 AccUP1 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc206 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc201 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc724 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc415 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc417 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc435 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2227 Acc712 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGCCGGGAACAAAAATACACGGA 2227 Acc101 AGTCTGTAGGCCAGCTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGA 2242 Acc715 AGTCTGTAGGCCAGCTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGA 2242 Acc706 AGTCTGTAGGCCAGCTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGA 2242 Acc624 AGTCTGTAGGCCAGCTAAAACGGATCAGTAGCATACTTGGGGGGAACAAAAATACACGGA 2242 Acc1 AGTCTGTAGGCCAGCTAAAACGGATCAATAGCATACTTGGGGGGAACAAAAATACACGGA 2191 Acc440 AGTCTGTAGGCCAGCTAAAACGGATCAATAGTATACTTGGAGGGAACAAAAAAACACGGG 2191 Acc868 AGTCTGTAGGCCAGCTAAAACGGATCAATAGTATACTTGGAGGGAACAAAAAAACACGGG 2205 Acc718 AGTCTGTAGGCCAGCTAAAACGGATCAATAGTATACTTGGAGGGAACAAAAAAACACGGG 2191 **** *** ***************** *** ******* ***** ***** ****** Acc414 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc420 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc761 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc504 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc563 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc757 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc848 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Tsuyuake_Pikm AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Kusabue_Pik AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Kanto51_Pik AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 K60_Pikp AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc108 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc130 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc719 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc729 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc710 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc709 AGGGGCTGAGGTTGCCTCAAGAAAAAAGTAAGAAGCCAATTAAAAACCCGTCGCCTCAAG 2218 Acc220 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Nipponbare AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc224 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 AccUP3 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 AccUP1 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc206 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc201 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc724 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc415 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc417 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc435 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc712 AGGGGCTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2287 Acc101 AGGGGTTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2302 Acc715 AGGGGTTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2302 Acc706 AGGGGTTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2302 Acc624 AGGGGTTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2302 Acc1 AGGGGTTGAGGTTGCCTCAAGAAAAAAGAAATAAGGCAATGAAAAACCCGTCACCTCAAG 2251 Acc440 AGGGGCTGAGGTTGCCTCAAGAAAAAGGAAATAAGACAATTAAAAACCCGTTGCCTCAAG 2251 Acc868 AGGGGCTGAGGTTGCCTCAAGAAAAAGGAAATAAGACAATTAAAAACCCGTTGCCTCAAG 2265 Acc718 AGGGGCTGAGGTTGCCTCAAGAAAAAGGAAATAAGAG----------------------- 2228 ***** ******************** * ** *** Ashikawa et al. Supplementary Fig. S2 (20/28)

21 Acc414 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc420 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc761 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc504 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc563 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc757 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc848 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Tsuyuake_Pikm GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Kusabue_Pik GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Kanto51_Pik GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 K60_Pikp GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc108 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc130 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc719 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc729 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc710 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc709 GAAAAACAAAGGAGCCCGCAAAGAAAGGATTCTTATCCCAAGAAAAAGGTAAAGGCGCAA 2278 Acc220 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Nipponbare GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc224 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 AccUP3 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 AccUP1 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc206 GTAAAACAAAGGAGCCTGCAGAGAAAGGATCCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc201 GTAAAACAAAGGAGCCTGCAGAGAAAGGATCCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc724 GTAAAACAAAGGAGCCTGCAGAGAAAGGATCCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc415 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc417 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc435 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc712 GTAAAACAAAGGAGCCTGCAGAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2347 Acc101 GTAAAACAAAGGAGCCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2362 Acc715 GTAAAACAAAGGAGCCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2362 Acc706 GTAAAACAAAGGAGCCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2362 Acc624 GTAAAACAAAGGAGCCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2362 Acc1 GTAAAACAAAGGAGCCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2311 Acc440 GTAAAACAAAGGAGCCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2311 Acc868 GTAAAACAAAGGAGCCTGCAAAGAAAGGATTCTTGTCCCAAGAAAAAGCTAAAGGCACAA 2325 Acc718 -------------------------------------------------TAAAGGCATAA 2239 ******* ** Acc414 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc420 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc761 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc504 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc563 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc757 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc848 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Tsuyuake_Pikm TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Kusabue_Pik TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Kanto51_Pik TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 K60_Pikp TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc108 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc130 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc719 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc729 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc710 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc709 TGAAAGCACTCCGTGTACTGTCAGGGATTGAGATTGTTGAGGAATCATCAGAAGTAGCTG 2338 Acc220 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Nipponbare TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc224 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 AccUP3 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 AccUP1 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc206 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc201 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc724 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc415 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc417 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc435 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc712 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2407 Acc101 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2422 Acc715 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2422 Acc706 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2422 Acc624 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2422 Acc1 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2371 Acc440 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2371 Acc868 TGAAGTCACTCCGTGTACTGTCAGGGATTGAGATCGTTGATGAATCAGCAGCAGTAGCTG 2385 Acc718 TGAAGTCACTCCATGTGCTGTCAGGGATTGAGATCGATGAGGAATCAGCAGCTGTAGCTG 2299 **** ****** *** ***************** * *** ****** *** ******* Ashikawa et al. Supplementary Fig. S2 (21/28)

22 Acc414 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc420 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc761 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc504 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc563 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc757 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc848 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Tsuyuake_Pikm CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Kusabue_Pik CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Kanto51_Pik CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 K60_Pikp CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc108 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc130 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc719 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc729 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc710 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc709 CAGGCCTTCATCAGTTGACAGGGCTAAGGAAGCTTGCCATATACAAGCTCAATATAACAA 2398 Acc220 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Nipponbare CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc224 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 AccUP3 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 AccUP1 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc206 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc201 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc724 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc415 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc417 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc435 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2467 Acc712 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATTTACAAGCTCAAAATAAGCG 2467 Acc101 CAAGCCTTCATCAGTTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2482 Acc715 CAAGCCTTCATCAGTTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2482 Acc706 CAAGCCTTCATCAGTTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2482 Acc624 CAAGCCTTCATCAGTTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2482 Acc1 CAAGCCTTCATCAGTTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2431 Acc440 CAAGCCTTCATCAGTTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2431 Acc868 CAAGCCTTCATCAGTTGACAGGATTAAGGAAGCTTGCCATATACAAGCTCAAAATAAGCG 2445 Acc718 CAAGCCTTCATCAGTTGACAGGACTAAGGAAGCTTGCCATATACAAGCTCAACATAGAAT 2359 ** ******************* **************** *********** *** Acc414 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc420 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc761 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc504 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc563 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc757 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc848 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Tsuyuake_Pikm AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Kusabue_Pik AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Kanto51_Pik AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 K60_Pikp AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc108 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc130 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc719 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc729 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc710 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc709 AGGGTGGTGATACCTTCAAACAATTACAGTCCTCCATTGAGTACCTTGGCAGCTGTGGTC 2458 Acc220 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Nipponbare AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc224 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 AccUP3 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 AccUP1 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc206 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc201 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc724 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc415 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc417 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc435 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc712 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2527 Acc101 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2542 Acc715 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2542 Acc706 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2542 Acc624 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2542 Acc1 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2491 Acc440 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCATCTGCGGCC 2491 Acc868 AGGAAAATGATACATTCAAAGAATTACTCTCCTCTATTGAGTACCTTGGCATCTGCGGCC 2505 Acc718 GGGGAAGTGAAACATTCCAAGAATTACGCTCCTCTATTGAGTACCTTGGCAGCTGCGGCC 2419 ** *** ** *** ** ****** ***** **************** *** ** * Ashikawa et al. Supplementary Fig. S2 (22/28)

23 Acc414 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc420 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc761 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc504 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc563 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc757 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc848 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Tsuyuake_Pikm TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Kusabue_Pik TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Kanto51_Pik TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 K60_Pikp TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc108 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc130 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc719 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc729 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc710 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc709 TGCAGACTCTGGCCATCAATGATGAGAATTCTGAATTTATCAACTCACTGG------GCG 2512 Acc220 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Nipponbare TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc224 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 AccUP3 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 AccUP1 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc206 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc201 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc724 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc415 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc417 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc435 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc712 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTAT------ACA 2581 Acc101 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACT 2602 Acc715 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACT 2602 Acc706 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACT 2602 Acc624 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTGCCCCTGCACT 2602 Acc1 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCACTGCACCTGCACT 2551 Acc440 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCATCGCACCTGCACT 2551 Acc868 TGCAGACTCTGGCCATCAATGATGAGAATTCTAAATTTATCAACTCATCGCACCTGCACT 2565 Acc718 TGCAGACTCTGGCCATCAATGATGAGAATTCTAACTTTATCAACTCATTGG------ACG 2473 ******************************** * ************ * Acc414 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc420 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc761 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc504 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc563 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc757 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc848 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Tsuyuake_Pikm ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Kusabue_Pik ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Kanto51_Pik ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 K60_Pikp ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc108 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc130 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc719 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc729 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc710 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc709 ACATGCCCGCGCCTCCAAGATATCTTGTCGCCCTTGAGCTGTCTGGCAAGTTGGAGAAGC 2572 Acc220 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Nipponbare ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc224 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 AccUP3 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 AccUP1 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc206 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc201 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc724 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc415 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc417 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc435 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc712 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGAAATGGC 2641 Acc101 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGC 2662 Acc715 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGC 2662 Acc706 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGC 2662 Acc624 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGC 2662 Acc1 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGC 2611 Acc440 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGC 2611 Acc868 ACATGTCTGCACCTCCAAGATATCTAGTCTCCCTTGAGCTGTCCGGCAAGTTGGACTGGC 2625 Acc718 GCATGTCCGCACCTCCAAGATATCTCATCGCCCTTGAGCTGTCCGGCAAGTTGTACAGGC 2533 **** * ** ************** ** ************* ********* * ** Ashikawa et al. Supplementary Fig. S2 (23/28)

24 Acc414 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc420 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc761 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc504 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc563 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc757 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc848 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Tsuyuake_Pikm TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Kusabue_Pik TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Kanto51_Pik TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 K60_Pikp TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc108 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc130 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc719 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc729 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc710 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc709 TACCCAAGTGGATCACCAGCATCACTACTCTCAACAAGCTAACCATATCTGTAACAGTTC 2632 Acc220 TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Nipponbare TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc224 TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 AccUP3 TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 AccUP1 TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc206 TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc201 TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc724 TACCTGAGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc415 TACCTGGGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc417 TACCTGGGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc435 TACCTGGGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2701 Acc712 TACCTGGGTGGATCACCAGCATTACTACTCTCAACAGGTTAACCATATCTATAACAGTTC 2701 Acc101 TACCTGTGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2722 Acc715 TACCTGTGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2722 Acc706 TACCTGTGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2722 Acc624 TACCTGTGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2722 Acc1 TACCTGTGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2671 Acc440 TACCTGTGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2671 Acc868 TACCTGTGTGGATCACCAGCATTACTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2685 Acc718 TACCCGAGTGGATCACCAGCATTGCTACTCTCAACAAGTTAACCATATCTATAACAGTTC 2593 **** *************** ************ * *********** ********* Acc414 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc420 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc761 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc504 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc563 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc757 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc848 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Tsuyuake_Pikm TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Kusabue_Pik TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Kanto51_Pik TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 K60_Pikp TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc108 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc130 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc719 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc729 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc710 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc709 TTAGGACTGAAACTTTGGAGATCCTCCACATTTTACCTTCATTGTTTTCCCTCACCTTCG 2692 Acc220 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Nipponbare TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc224 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 AccUP3 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 AccUP1 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc206 TTGCGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc201 TTGCGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc724 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc415 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc417 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc435 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc712 TTACGACTGAAACTTTGGAGATCCTCCGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2761 Acc101 TTACGACTAAAACTTTGGAGATCCTCTGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2782 Acc715 TTACGACTAAAACTTTGGAGATCCTCTGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2782 Acc706 TTACGACTAAAACTTTGGAGATCCTCTGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2782 Acc624 TTACGACTAAAACTTTGGAGATCCTCTGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2782 Acc1 TTACGACTGAAACTTTGGAGATCCTCTGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2731 Acc440 TTACGACTGAAACTTTGGAGATCCTCTGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2731 Acc868 TTACGACTGAAACTTTGGAGATCCTCTGCAATTTACCTTCATTGTTTTCCCTCACCTTTG 2745 Acc718 TTACGACTGAAACTTTGGAGATCCTCCGCAGTTTACCTTCATTGTTTTCCCTCACCTTCG 2653 ** **** ***************** ** *************************** * Ashikawa et al. Supplementary Fig. S2 (24/28)

25 Acc414 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc420 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc761 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc504 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc563 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc757 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc848 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Tsuyuake_Pikm CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Kusabue_Pik CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Kanto51_Pik CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 K60_Pikp CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc108 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc130 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc719 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc729 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc710 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc709 CCTTTTCACTTAGTGCAGCGAAGCAGGATCAGGACATAATAAAGGACATCCTTGAGAATA 2752 Acc220 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Nipponbare CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc224 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 AccUP3 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 AccUP1 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc206 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc201 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc724 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc415 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc417 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc435 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc712 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2821 Acc101 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2842 Acc715 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2842 Acc706 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2842 Acc624 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2842 Acc1 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2791 Acc440 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2791 Acc868 CCTTTTCACTTAGTGCAGCGAAGCAAGATCAGGACACAGTAAAGGGCATCCTTGAGGACA 2805 Acc718 CCTTTTCACTTAGTGCAGCGAAGCAGGATCTGGACGAAATAAAGGACATCCTTGAGAACA 2713 ************************* **** **** * ****** ********** * * Acc414 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc420 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc761 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc504 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc563 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc757 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc848 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Tsuyuake_Pikm ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Kusabue_Pik ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Kanto51_Pik ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 K60_Pikp ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc108 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc130 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc719 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc729 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc710 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc709 ATAAATTGGACAGTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2812 Acc220 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Nipponbare ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc224 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 AccUP3 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 AccUP1 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc206 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc201 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc724 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc415 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc417 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc435 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc712 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2881 Acc101 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2902 Acc715 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2902 Acc706 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2902 Acc624 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2902 Acc1 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2851 Acc440 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2851 Acc868 ATAAATTGGCCACTGACGGGGAAATCGTCATTCCAGCTAAAGAATTCAAGAGTCTTAAGC 2865 Acc718 ATAAATTGGCCACTGATGGGGAAATCGTCATTCCAGCTGAAGGATTCAAGAGTCTTAAGC 2773 ********* ** *** ********************* *** ***************** Ashikawa et al. Supplementary Fig. S2 (25/28)

26 Acc414 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc420 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc761 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc504 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc563 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc757 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc848 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Tsuyuake_Pikm TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Kusabue_Pik TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Kanto51_Pik TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 K60_Pikp TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc108 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc130 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc719 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc729 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc710 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc709 TGCTTCGCTTCTTTGCACCTTTAGTGCCGAAGCTCAGCTTTTTGGACAAGAATGCAATGC 2872 Acc220 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Nipponbare TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc224 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 AccUP3 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 AccUP1 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc206 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc201 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc724 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc415 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc417 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc435 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc712 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2941 Acc101 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2962 Acc715 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2962 Acc706 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2962 Acc624 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2962 Acc1 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2911 Acc440 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2911 Acc868 TGCTTCGCTTCTTTGCACCTTTCGTGCCAAAGCTCAGCTTTCCGGACAAGAGTGCAATGC 2925 Acc718 TGCTTCGTTTCTTTGCACCTTTCGTGCCGAAGCTCAGCTTTTCGGACAAGAATGCAATGC 2833 ******* ************** ***** ************ ******** ******** Acc414 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc420 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc761 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc504 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc563 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc757 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc848 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Tsuyuake_Pikm CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Kusabue_Pik CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Kanto51_Pik CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 K60_Pikp CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc108 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc130 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc719 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc729 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc710 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc709 CAGCACTCGAAATCATTGAAATGCGGTTTAAAGACTTCGAAGGTCTATTTGGCATCGAAA 2932 Acc220 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Nipponbare CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc224 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 AccUP3 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 AccUP1 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc206 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc201 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc724 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc415 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc417 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc435 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc712 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3001 Acc101 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3022 Acc715 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3022 Acc706 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3022 Acc624 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 3022 Acc1 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 2971 Acc440 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 2971 Acc868 CAGCACTCGAAATCATTGAAATGCGGTTTCAAGAATTTGAGGGTCTATTCGGCATCGAAA 2985 Acc718 CAGCACTTGAAATCATTGAAATGCGGTTTAAAGACTTCGAGGGTCTATTCGGCATCGAAA 2893 ******* ********************* **** ** ** ******** ********** Ashikawa et al. Supplementary Fig. S2 (26/28)

27 Acc414 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc420 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc761 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc504 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc563 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc757 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc848 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Tsuyuake_Pikm TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Kusabue_Pik TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Kanto51_Pik TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 K60_Pikp TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc108 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc130 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc719 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc729 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc710 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc709 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGTGATGGGGCAGAAGCAATAACCA 2992 Acc220 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Nipponbare TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc224 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 AccUP3 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 AccUP1 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc206 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc201 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc724 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc415 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc417 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc435 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc712 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3061 Acc101 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3082 Acc715 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3082 Acc706 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3082 Acc624 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3082 Acc1 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3031 Acc440 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3031 Acc868 TCCTTGAAAATCTCCGTGAGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 3045 Acc718 TACTTGAAAATCTCCGTGGGGTGCATCTCAAAGTTAGCGATGGGGCAGAAGCAATAACCA 2953 * **************** ****************** ********************** Acc414 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc420 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc761 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc504 AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc563 AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc757 AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc848 AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Tsuyuake_Pikm AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Kusabue_Pik AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Kanto51_Pik AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 K60_Pikp AGTTCCTTGTAAATGATTTGAAGGTTAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc108 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc130 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc719 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc729 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc710 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc709 AGTTCCTTGTAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3052 Acc220 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Nipponbare AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc224 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 AccUP3 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 AccUP1 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc206 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc201 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc724 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc415 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc417 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc435 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc712 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3121 Acc101 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3142 Acc715 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3142 Acc706 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3142 Acc624 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3142 Acc1 AGTTCCTAGTAAGTGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3091 Acc440 AGTTCCTAGTAAGTGATTTGAAGGATCATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3091 Acc868 AGTTCCTAGTAAGTGATTTGAAGGATCATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3105 Acc718 ATTTCCTAGCAAATGATTTGAAGGATAATACTGAGAAACCAAAAGTATTTGTTGATGGCA 3013 * ***** * ** *********** * ********************************* Ashikawa et al. Supplementary Fig. S2 (27/28)

28 Acc414 TCGTCACTGCATGA 3066 Acc420 TCGTCACTGCATGA 3066 Acc761 TCGTCACTGCATGA 3066 Acc504 TCGTCACTGCATGA 3066 Acc563 TCGTCACTGCATGA 3066 Acc757 TCGTCACTGCATGA 3066 Acc848 TCGTCACTGCATGA 3066 Tsuyuake_Pikm TCGTCACTGCATGA 3066 Kusabue_Pik TCGTCACTGCATGA 3066 Kanto51_Pik TCGTCACTGCATGA 3066 K60_Pikp TCGTCACTGCATGA 3066 Acc108 TCGTCACTGCATGA 3066 Acc130 TCGTCACTGCATGA 3066 Acc719 TCGTCACTGCATGA 3066 Acc729 TCGTCACTGCATGA 3066 Acc710 TCGTCACTGCATGA 3066 Acc709 TCGTCACTGCATGA 3066 Acc220 TCGTCACTGCATGA 3135 Nipponbare TCGTCACTGCATGA 3135 Acc224 TCGTCACTGCATGA 3135 AccUP3 TCGTCACTGCATGA 3135 AccUP1 TCGTCACTGCATGA 3135 Acc206 TCGTCACTGCATGA 3135 Acc201 TCGTCACTGCATGA 3135 Acc724 TCGTCACTGCATGA 3135 Acc415 TCGTCACTGCATGA 3135 Acc417 TCGTCACTGCATGA 3135 Acc435 TCGTCACTGCATGA 3135 Acc712 TCGTCACTGCATGA 3135 Acc101 TCGTCACTGCATGA 3156 Acc715 TCGTCACTGCATGA 3156 Acc706 TCGTCACTGCATGA 3156 Acc624 TCGTCACTGCATGA 3156 Acc1 TCGTCACTGCATGA 3105 Acc440 TCGTCACTGCATGA 3105 Acc868 TCGTCACTGCATGA 3119 Acc718 TCGTCACTGCATGA 3027 ************** Ashikawa et al. Supplementary Fig. S2 (28/28)


Download ppt "Acc414 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc420 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC 60 Acc761 ATGGAGTTGGTGGTAGGTGTTTCCGAAGCCACCATGAAATCTCTCTTGGGCAAGCTGGGC."

Similar presentations


Ads by Google