Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Synthesis.

Similar presentations


Presentation on theme: "Protein Synthesis."— Presentation transcript:

1 Protein Synthesis

2 DNA Double stranded Complimentary Composed of Nucleotides

3 DNA replication DNA Helicase – breaks hydrogen bonds holding complimentary strands together Forms replication fork Leading strand Lagging strand

4 DNA Replication DNA is read 5’ to 3’

5 Leading Stand Helicase -> RNA pimase -> DNA polymerase

6 Lagging Stands Helicase -> RNA primase -> DNA polymerase -> okazaki fragments -> DNA polymerase cleans up RNA primase strand -> DNA ligase

7 Movie Replication

8 Protein Synthesis 2 parts Transcription Translation
To copy segment of DNA Translation To translate the language of nitrogenous bases into amino acids

9 RNA vs. DNA Difference between mRNA and DNA
Single stranded vs. Double stranded The sugar has an extra oxygen, ribose vs. deoxyribose Uses uricil “U” instead of thymine

10 Transcription Production of mRNA
RNA primase binds to DNA at a promoter region RNA polymerase adds bases copying the gene

11 Movie Transcription

12 Packaged mRNA is processed to leave the nucleus Extras are cut out
Splicosomes Introns Exons Poly-A tail 5’ cap

13 Translation A G C U mRNA has left the nucleus. Binds with ribosome
mRNA -> tRNA -> amino acids -> folded proteins What’s the Problem? mRNA UGGCUUGCAUGCCGGAGUCCACGUAAUCA Into Amino acids A G C U Amino Acids

14 Translation tRNA consists of a Codon – 3 base sequence on
Anticodon – 3 bases that match codon Amino acid Codon – 3 base sequence on mRNA

15 Translation mRNA -> tRNA -> amino acids -> proteins

16 Translation mRNA UGGCUUGCAUGCCGGAGUCCACGUAAUCA

17 Movie Translation


Download ppt "Protein Synthesis."

Similar presentations


Ads by Google