1. Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms? Gene libraries/Genetic testing Genetically-modified crops and livestock Protein-producing bacteria Gene therapy

2. What is DNA? The cell’s nucleus contains chromosomes (46 chromosomes in human cells). Each chromosome is a molecule of DNA. Each molecule of DNA is like a cookbook of protein recipes. The recipes are written using a four- nucleotide (four letter) alphabet. DNA is double-stranded. Each recipe is on one strand (the other strand is like a back-up).

3. What is do genes do? 2 Alpha Chains (141 amino acids each) 2 Beta Chains (146 amino acids each) Normal Hemoglobin 2 Alpha Chains (141 amino acids each) 2 Beta Chains (145 normal amino acids, 1 changed amino acid) Valine instead of Glutamate Sickle-Cell Hemoglobin If a chromosome is a cookbook, each gene is one protein recipe within that cookbook. Small changes in a recipe can lead to big changes in the protein that is produced. A change of one nucleotide out of around 900 nucleotides changes the hemoglobin protein from normal to the sickle-cell form! (That’s like one typo in a 3-page paper).

4. What are Restriction Enzymes? 5’ AACTGAATTCCGGATCCGACTAGAATTCATCT 3’ 3’ TTGACTTAAGGCCTAGGCTGATCTTAAGTAGA 5’ DNA is double-stranded. The nucleotides in the two strands are complementary: A pairs with T and G pairs with C. Enzymes, made by bacteria, that recognize specific DNA nucleotide sequences, and make single-stranded cuts in the DNA. EcoRI Recognizes GAATTC Bam HI Recognizes GGATCC

5. Restriction Enzymes: EcoRI as an example There are dozens of restriction enzymes now available. Each has a unique recognition sequence and cut site. There are two EcoRI recognition sites in the DNA sequence that is shown. The EcoRI recognition sequence is a palindrome (the sequence is 5’ GAATTC 3’ on both strands). EcoRI Recognizes GAATTC Bam HI Recognizes GGATCC 5’ AACTGAATTCCGGATCCGACTAGAATTCATCT 3’ 3’ TTGACTTAAGGCCTAGGCTGATCTTAAGTAGA 5’

6. Restriction Enzyme: EcoRI Active Site The EcoRI active site binds to DNA where ever 5’ GAATTC 3’ occurs. This works with any DNA. EcoRI Recognizes GAATTC Bam HI Recognizes GGATCC 5’ AACTGAATTCCGGATCCGACTAGAATTCATCT 3’ 3’ TTGACTTAAGGCCTAGGCTGATCTTAAGTAGA 5’ EcoRI

7. Restriction Enzymes: EcoRI Endonuclease Activity EcoRI cuts the sugar-phosphate backbone between the G and A in the regognition sequence GAATC. The cuts in the two strands are off-set from one another. This leaves short single-stranded ends. The ends are called sticky ends because they will stick to each other (they have complementary sequence). EcoRI Recognizes GAATTC Bam HI Recognizes GGATCC AATTCATCT GTAGA AACTG TTGACTTA A AATTCCGGATCCGACTAG GGCCTAGGCTGATCTTAA

8. How are transgenic organisms made? Plasmids are collected from bacteria. Plasmids are small bits of DNA that can be taken up and given off by bacteria. They can be used as vectors for getting foreign DNA into bacteria. Plasmid DNA is collected and cut with a restriction enzyme. DNA of interest (like human DNA) is collected and cut with the same restriction enzyme. This results in human DNA and plasmid DNA having complementary sticky ends. Human DNA and plasmid DNA is mixed together and their sticky ends will bind with one another to form recombinant plasmids. Recombinant plasmids are then mixed with, and taken up by, bacterial cells. This creates recombinant (or transgenic or genetically-modified) organisms. The same process can be used to make other types of transgenic organisms as long as we have an appropriate vector.

9. Single-Gene versus Multifactorial Traits If all traits were determined by single genes, this is how the world would look. Thankfully, that’s not how life is. We can only modify single genes. Thus, we only have ability to alter a very limited array of genetic traits. Most complex traits are influenced by many genes and many environmental factors. We call these multifactorial traits. These account for the amazing variation we see among organisms in the world.

10. What can be done with transgenic organisms: Gene Libraries/Genetic Tests Each of the genes of an organism can be inserted into a different transgenic bacterium. These can be maintained in their own cultures. The entire collection of these transgenic bacterial strains is called a gene library. Suppose you want to be tested to see if you carry BRCA1 (one of the major genes involved in familial breast cancer). Your DNA can be collected. We can then take the BRCA1 gene from the human gene library and see if it sticks to your DNA. The BRCA1 gene will stick if your DNA has complementary sequence to the BRCA1 gene. If that is the case, you must carry the BRCA1 gene. In theory, we can do this with any other gene in our gene library (in practice, not all of those genetic tests has yet been developed).

11. What can be done with transgenic organisms: Genetically-Modified Crops and Livestock What type of crops and livestock have been genetically modified? Plants: Corn and Soy (Bt-Producing, Roundup Resistant) Tomato (Slow ripening) Strawberries (Frost-resistant) Bananas (Hepatitis B antigen) Animals: Cows (Bovine Growth Hormone) Sheep (Fibrinogen production) Chicken (Avian Flu Resistance) Controversies (http://www.ornl.gov/sci/techresources/Human_Genome/elsi/gmfood.shtml) * Safety * Access and Intellectual Property * Ethics * Labeling * Society

12. What can be done with transgenic organisms: Protein-Producing Bacteria Genetically-modified bacteria are now grown in mass cultures to produce human proteins. This is possible because bacteria read the genetic code in identical ways to humans (and other organisms). Human proteins produced by bacteria: Insulin Human Growth Hormone Blood Clotting Factors Erythropoietin Interferon

13. What can be done with transgenic organisms: Gene Therapy Person with a single gene mutation that causes a health disorder Good copy of human gene from a donor Harmless virus genetically modified to contain good copy of human gene. Sick person’s cells intentionally infected with genetically modified virus. Viral DNA (including good human gene) integrates into sick person’s chromosome. Sick person’s cells begin to produce functional protein. Sick person is CURED!