2. Chapter 12 Gene Expression Unlocking the secrets of DNA

3. DNA is difficult to understand, even for the cell. The nucleotide sequence of DNA is the blueprint for building proteins, but the ribosomes responsible for making proteins cannot “read” DNA.

4. Ribonucleic Acid 1) Messenger RNA –Single strand, complimentary copy of DNA created in nucleus; contains triplet codons 2) Transfer RNA –Cloverleaf-shaped strand that picks up amino acids and delivers them to the ribosome; contains triplet anti-codons 3) Ribosomal RNA –Makes up ribosomes; joins amino acids together to create a growing protein chain

5. RNA vs DNA RNA is single instead of double strand RNA has different sugar (ribose) RNA has uracil which takes the place of thymine RNA moves out of nucleus & controls protein synthesis

6. RNA DNA RNA polymerase Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) Transcription: the production of RNA from the DNA code

7. Protein Synthesis 1. Transcription –Occurs in nucleus –DNA makes a complimentary copy in the form of M-RNA in a process similar to replication –M-RNA moves out of nucleus and to ribosomes in the cytoplasm

8. Transcription

9. Benefits of transcription Transcribed copies of the DNA (in the form of RNA) are used instead of the original DNA. In eukaryotes, DNA in the cytoplasm is degraded but RNA is not.

10. How does transcription work? 1.DNA double helix must be separated at the hydrogen bonds between nitrogen bases. 2.Only one DNA strand is “read” by RNA polymerase. 3.RNA polymerase constructs an RNA polymer.

11. Building RNA polymer DNA  (codes for) RNA A  U T  A C  G G  C

12. Click on image to play video.

13. What happens to the RNA once it is created? In prokaryotes, the RNA is immediately translated. In eukaryotes, the RNA is processed. –Introns removed –Exons joined together

14. RNA processing Introns (segments of useless genes) are removed, leaving on exons (expressed genes).

15. 2. Translation –Occurs in cytoplasm –T-RNA delivers amino acids to ribosomes & joins complimentary anti- codons, putting amino acids in proper order –R-RNA forms peptide bonds to join amino acids into a protein molecule –(T-RNA returns to pick up new amino acids)

16. Translation

18. Ribosomes use this decoding scheme to determine how to build the appropriate protein.

19. How does the decoding work? RNA: AUGCGAGGGAGAUUAUAGGAC Ribosomes read AUG – CGA – GGG – AGA – UUA – UAG – GAC. Each 3 nucleotide “word” is called a codon.

21. Try to decode AUG CGA GGG AGA UUA UAG GAC. Met – Arg – Gly – Arg – Leu - stop

22. What happens to Met–Arg–Gly–Arg–Leu–stop? The ribosomes create an amino acid polymer that is folded into a protein. The original DNA code, transcribed to RNA, instructs the cell to make a protein for a specific function.

23. Click on image to play video.

24. What happens if there is a mutation in the original DNA? Point mutations: change of one nucleotide sequence This may or may not affect the amino acid sequence, depending upon where the mutation occurs in the DNA sequence.

25. Gene mutations Point mutations –Change one nucleotide or just a few nucleotides in a gene –Examples: sickle cell anemia & cystic fibrosis Frame-shift mutations –The reading pattern is displaced and “shifts” into new positions –Examples: duchenne Muscular Dystrophy

26. Frame shift mutations The cat and the rat ran far. The ca and the rat ran far. tr

27. Click on image to play video.

28. Mutations Disadvantages: –Abnormal, even lethal genes can be passed on to offspring Advantages: –New, stronger genes can be passed on to offspring

29. Chromosomal mutations Deletion = Insertion = Inversion = Translocation = A B C D E F G H A B C D E G H A B C D J E F G H A B C D E G F H G H W X Y Z A B C D E F

30. DNA 5’ A T G C C T G A A T G A 3’ 3’ T A C G G A C T T A C T 5’ coding strand mRNA A UG C C U G A A U G A codons tRNA U A C G G A C U U A C U anti codons amino acids Met Pro Glu stop protein

33. The Central Dogma theory of Biology (DNA RNA protein cell functions)

34. Animation of translation Click to automatically start animation.

36. Single Messenger RNA Strand This is a ribosome.

37. Met Single Messenger RNA Strand

38. Met Single Messenger RNA Strand Arg

39. Met Single Messenger RNA Strand Arg

40. Met Single Messenger RNA Strand Arg

41. Met Single Messenger RNA Strand Arg

42. Met Single Messenger RNA Strand Arg

43. Met Single Messenger RNA Strand Arg

44. Met Single Messenger RNA Strand Arg

45. Met Single Messenger RNA Strand Arg

46. Met Single Messenger RNA Strand Arg

47. Single Messenger RNA Strand Met Arg

48. Single Messenger RNA Strand Met Arg

49. Single Messenger RNA Strand Met Arg

50. Single Messenger RNA Strand Met Arg

51. Single Messenger RNA Strand Met Arg

52. Single Messenger RNA Strand MetArgGly

53. Single Messenger RNA Strand MetArgGly

54. Single Messenger RNA Strand Met Arg Gly

55. Single Messenger RNA Strand Met Arg Gly

56. Single Messenger RNA Strand MetArgGly

57. Single Messenger RNA Strand MetArgGly

58. Single Messenger RNA Strand MetArgGly

59. Single Messenger RNA Strand MetArgGly

60. Single Messenger RNA Strand MetArgGly

61. Single Messenger RNA Strand MetArgGly

62. Single Messenger RNA Strand MetArgGly

63. Single Messenger RNA Strand Met Arg Gly

64. Single Messenger RNA Strand Met Arg Gly

65. Single Messenger RNA Strand Met Arg Gly

66. Single Messenger RNA Strand Met Arg Gly

67. Single Messenger RNA Strand Met Arg Gly

68. Single Messenger RNA Strand Met Arg Gly

69. Single Messenger RNA Strand Met Arg Gly

70. Single Messenger RNA Strand Met Arg Gly Lys

71. Single Messenger RNA Strand Met Arg Gly Lys

72. Single Messenger RNA Strand Met Arg Gly Lys

73. Single Messenger RNA Strand Met Arg Gly Lys

74. Single Messenger RNA Strand Met Arg Gly Lys

75. Single Messenger RNA Strand Met Arg Gly Lys

76. Single Messenger RNA Strand Met Arg Gly Lys

77. Single Messenger RNA Strand Met Arg Gly Lys

78. Single Messenger RNA Strand Met Arg Gly Lys

79. Single Messenger RNA Strand Met Arg Gly Lys

80. Single Messenger RNA Strand Met Arg Gly Lys

81. Single Messenger RNA Strand Met Arg Gly Lys

82. Single Messenger RNA Strand Met Arg Gly Lys

83. Single Messenger RNA Strand Met Arg Gly Lys

84. Single Messenger RNA Strand Met Arg Gly Lys

85. Met Arg Gly Lys

86. Met Arg Gly Lys

87. MetArg Gly Lys Stop

88. MetArg Gly Lys Stop

89. MetArg Gly Lys Stop

90. MetArg Gly Lys Stop

91. MetArg Gly Lys Stop

92. MetArg Gly Lys Stop

93. MetArg Gly Lys Stop

94. MetArgGlyLysStop

95. MetArg Gly Lys Stop

96. MetArg Gly Lys Stop

97. MetArg Gly Lys Stop

98. MetArg Gly Lys Stop

99. MetArg Gly Lys Stop

100. MetArg Gly Lys Stop

101. MetArg Gly Lys Stop

102. MetArg Gly Lys Stop

103. MetArg Gly Lys Stop

104. MetArg Gly Lys Stop

105. MetArg Gly Lys Stop

106. MetArg Gly Lys Stop

107. Protein Synthesis overview

108. Transcription: DNA codes for RNA RNA polymerase A  U T  A C  G G  C

109. mRNA processing The RNA polymer made = messenger RNA (mRNA) DNA has “junk” genes. These are called introns (useless pieces of RNA made as a result of useless DNA). Introns are cut (“spliced”). Exons are remaining RNA nucleotides carrying the actual DNA code. Exons are translated.

111. Translation: RNA to amino acids Ribosomes “read” codons. AUG = start codon tRNA with anticodons have amino acids attached.

112. Translation Ribosomes read until the codon that indicates STOP.

113. Amino acid chain The amino acid chain made in translation is then folded. Folded proteins = enzymes, pigments, etc. Proteins made = phenotype