1. A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits? Section 13-1 Interest Grabber Go to Section:

2. 1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed.” 2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on. 3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected. Section 13-1 Interest Grabber continued Go to Section:

3. Interest Grabber A New Breed 1.Students should refer only to breeds with which they are familiar. 2. Additional traits might include shape of ears, shape of muzzle (pointed or square), or length of legs with respect to body. 3. Students will likely assume that traits of the cross-breed are intermediate between those of the two parent breeds.

4. 13–1Changing the Living World A.Selective Breeding 1.Hybridization 2.Inbreeding B.Increasing Variation 1.Producing New Kinds of Bacteria 2.Producing New Kinds of Plants Section 13-1 Section Outline Go to Section:

5. Selective breeding – method of improving a species by allowing only those individual organisms with desired characteristics to produce the next generation (applies to nearly all domestic animals and most crop plants) Hybridization – breeding technique that involves crossing dissimilar individuals to bring together the best of both organisms Inbreeding – continued breeding of individuals with similar characteristics

6. which crosses consists of Selective Breeding for example Inbreeding Hybridization Similar organisms Dissimilar organisms for example Organism breed A Organism breed B Retains desired characteristics Combines desired characteristics which which crosses which Section 13-1 Concept Map Go to Section:

7. Increasing Variation Mutation – inheritable changes in DNA; breeders can increase the mutation rate by using radiation and chemicals (oil-eating bacteria) Polyploid – condition of having many sets of chromosomes; usually fatal in animals; plant breeders use drugs that prevent chromosomal separation during meiosis (bananas, citrus fruits, day lilies)

8. The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces? Section 13-2 Interest Grabber Go to Section:

9. 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Section 13-2 Interest Grabber continued Go to Section:

10. The Smallest Scissors in the World 1–2. Remind students to check their copies for accuracy before they begin the next step. 3. Students should find three occurrences of the sequence: GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA

11. 13–2Manipulating DNA A.The Tools of Molecular Biology 1.DNA Extraction 2.Cutting DNA 3.Separating DNA B.Using the DNA Sequence 1.Reading the Sequence 2.Cutting and Pasting 3.Making Copies Section 13-2 Section Outline Go to Section:

12. Words to Know Genetic engineering – making changes in the DNA code of a living organism 1.DNA Extraction – cells are opened and the DNA is separated from the other cell parts 2.Cutting DNA – restriction enzyme cuts a DNA sequence 3.Separating DNA – DNA fragments are separated and analyzed (gel electrophoresis)

13. Restriction Enzymes DNA molecules from most organisms are much too large to be analyzed, so biologists cut them precisely into smaller segments using restriction enzymes Hundreds are known Each one cuts DNA at a specific sequence of nucleotides Example: EcoRI finds the sequence CTTAAG on DNA

14. Recognition sequences DNA sequence Restriction enzyme EcoR I cuts the DNA into fragments. Sticky end Section 13-2 Restriction Enzymes Go to Section:

15. Recognition sequences DNA sequence Restriction enzyme EcoR I cuts the DNA into fragments. Sticky end Section 13-2 Restriction Enzymes Go to Section:

16. Gel Electrophoresis DNA is separated and analyzed Used to compare genomes of different organisms or different individuals Used to identify one particular gene out of millions of genes in an individual’s genome

17. Gel Electrophoresis DNA is separated and analyzed 1.A mixture of DNA fragments is placed at one end of a porous gel 2.An electric voltage is applied to the gel 3.When the power is turned on, DNA molecules, which are negatively charged, move toward the positive end of the gel 4.The smaller the DNA fragment, the faster it moves (It will be located at the end of gel.)

18. DNA plus restriction enzyme Mixture of DNA fragments Gel Power source Longer fragments Shorter fragments Section 13-2 Figure 13-6 Gel Electrophoresis Go to Section:

19. DNA Sequencing A complementary DNA strand is made using a small proportion of fluorescently labeled nucleotides Each time a labeled nucleotide is added, it stops the process of replication This produces a short color-coded DNA fragment When the mixture of fragments is separated on a gel, the DNA sequence can be read directly from the gel The pattern of colored bands tells the exact sequence of bases in the DNA

20. Fluorescent dye Single strand of DNA Strand broken after A Strand broken after C Strand broken after G Strand broken after T Power source Gel Section 13-2 Figure 13-7 DNA Sequencing Go to Section:

21. Recombinant DNA Lab machines known as DNA synthesizers can assemble short sequences of DNA “Synthetic” sequences can then be joined to “natural” ones using enzymes that splice DNA together The same enzymes make it possible to take a gene from one organism and attach it to the DNA of another organism Such DNA molecules are called recombinant DNA because they are produced by combining DNA from different sources

22. Polymerase Chain Reaction (PCR) Making copies of a particular gene 1.At one end of the piece of DNA, the biologist adds a short piece of DNA that is complementary to a portion of the sequence 2.At the other end, the biologist adds another short piece of complementary DNA These short pieces are known as “primers” because they provide a place for the DNA polymerase to start working.

23. PCR (cont’d.) 3.The DNA is heated to separate its two strands, then cooled to allow the primers to bind to the single- stranded DNA 4.DNA polymerase starts making copies of the region between the two primers 5.The copies serve as templates, so a few dozen cycles of replication can produce millions of copies 6.Invented by American, Kary Mulllis 7.The polymerase enzyme was found in bacteria living in the hot springs of Yellowstone National Park

24. DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCR cycles 1 DNA copies 1 2222 3434 4848 5 etc. 16 etc. Section 13-2 Figure 13-8 PCR Go to Section:

25. Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer. Section 13-3 Interest Grabber Go to Section:

26. 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2. Why would a person download a virus program? 3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA? Section 13-3 Interest Grabber continued Go to Section:

27. Sneaking In 1.A file can be downloaded from a diskette, a CD, or the Internet. 2. The computer user would not willingly download a virus but would download a program that was useful. 3. Possible answers: a useful protein or a strand of DNA that the cell would recognize and accept

28. 13–3Cell Transformation A.Transforming Bacteria B.Transforming Plant Cells C.Transforming Animal Cells Section 13-3 Section Outline Go to Section:

29. Words to Know Transformation - a cell incorporates DNA from outside the cell into its own DNA Bacteria can be transformed simply by placing them in a solution containing DNA molecules (Recall Griffith’s experiments.) Plasmid – small circular DNA molecule One way to make recombinant DNA is to insert a human gene into bacterial DNA. The new combination of genes is then returned to the bacterial cell, and the bacteria can produce the human protein.

30. Genetic Marker A gene that makes it possible to distinguish bacteria that carry the plasmid and foreign DNA Genes for resistance to antibiotics are commonly used as genetic markers Genetic markers are related to transformation because the DNA of the marker is integrated into one of the cell’s chromosomes Plasmids have genetic markers (They also serve as bacterial origins of replication.)

31. Recombinant DNA Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA Section 13-3 Knockout Genes Go to Section:

32. Human Cell Gene for human growth hormone Recombinant DNA Gene for human growth hormone Sticky ends DNA recombination DNA insertion Bacterial Cell Plasmid Bacterial chromosome Bacterial cell for containing gene for human growth hormone Section 13-3 Figure 13-9 Making Recombinant DNA Go to Section:

33. Recombinant plasmid Gene to be transferred Agrobacterium tumefaciens Cellular DNA Transformed bacteria introduce plasmids into plant cells Plant cell colonies Complete plant is generated from transformed cell Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Section 13-3 Figure 13-10 Plant Cell Transformation Go to Section:

34. The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey. Section 13-4 Interest Grabber Go to Section:

35. 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild? Section 13-4 Interest Grabber continued Go to Section:

36. The Good With the Bad 1.Students may say that a mouse with a humanlike immune system would be a good laboratory model for immune research. 2. Transgenic organisms might disrupt normal balances in ecosystems and could breed with natural populations, changing them.

37. 13–4Applications of Genetic Engineering A.Transgenic Organisms 1.Transgenic Microorganisms 2.Transgenic Animals 3.Transgenic Plants B.Cloning Section 13-4 Section Outline Go to Section:

38. Transgenic Microorganisms 1.Bacteria reproduce rapidly and are easy to grow 2.Human forms of proteins such as insulin, growth hormone, and clotting factor are now produced by transgenic bacteria 3.In the future, transgenic microorganisms may be used to fight cancer and develop the raw materials for plastics and synthetic fibers

39. Cloning Section 13-4 Flowchart A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The fused cell begins dividing, becoming an embryo. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal. Go to Section:

40. A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell The fused cell begins dividing normally. Embryo The embryo is placed in the uterus of a foster mother. Foster Mother The embryo develops normally into a lamb—Dolly Cloned Lamb Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. Section 13-4 Figure 13-13 Cloning of the First Mammal Go to Section: