1. A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits? On the next slide, work with a partner. Pick two breeds of dogs and give 4 characteristics for each. In the middle green circles, list those characteristics you might see if you bred the two dogs together. Section 13-1 Interest Grabber

3. 13–1 Changing the Living World A. Selective Breeding Hybridization -Zorses, wholphins, tigons, and beefaloes. Lepjags, zonkeys, camas, and bonanzees. These are some of the captive-bred mammalian hybrids that exist, and they're joined by a host of hybrid birds, fish, insects, and plants. Thanks to new techniques that allow scientists to isolate and compare DNA, more hybrids are turning up every year, and we're learning that some of them—such as the pizzly, a cross between a polar bear and a grizzly—can occur naturally in the wild.

4. 2. Inbreeding ``There are over 350 known, inherited diseases among purebred dogs, and that's pretty scary,'' said Alison Schaffer, a researcher at the University of California at Davis' Veterinary Genetics Laboratory. http://www.upei.ca/~cidd/intro.htm Link to Canine inherited disorders database

5. B. Increasing Variation Scientists and breeders can increase the genetic variation in a population by inducing mutations 1.Producing New Kinds of Bacteria a. Oil eating bacteria 2. Producing New Kinds of Plants a. Polyploidy i. Durham semolina wheat ii. Bananas iii. Citrus fruits

6. which crosses consists of Selective Breeding for example Inbreeding Hybridization Similar organisms Dissimilar organisms for example Organism breed A Organism breed B Retains desired characteristics Combines desired characteristics which which crosses which Section 13-1 Concept Map

7. The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

8. 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACG TTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

9. 13–2Manipulating DNA Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules. A.The Tools of Molecular Biology 1.DNA Extraction-interactive link http://learn.genetics.utah.edu/units/biotech/extraction/ 2. Cutting DNA-restriction enzymes- interactive link http://www3.interscience.wiley.com:8100/legacy/college/bo yer/0471661791/animations/agarose/agarose.htm 3. Separating DNA-interactive link http://learn.genetics.utah.edu/units/biotech/gel/

10. B. Using the DNA Sequence If scientists can figure out the sequence then they can use this knowledge to diagnose disease and to change the DNA. 1. Reading the Sequence interactive link http://www.pbs.org/wgbh/nova/genome/sequencer.html# 2. Cutting and Pasting-recombinant DNA video http://www.present.udel.edu/biotech/rDNA.html 3. Making Copies-interactive Polymerase Chain reaction: http://lifesciences.envmed.rochester.edu/movies/PCR_final.sw f

11. Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.

12. 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2.Why would a person download a virus program? 3.If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?

13. 13–3Cell Transformation During transformation, a cell takes in DNA from outside the cell. This external DNA becomes a component of the cell's DNA. A. Transforming Bacteria-interactive link-choose “techniques” http://www.dnai.org/b/index.html B. Transforming Plant Cells- interactive link. –scroll down and view “Gene Gun” http://plantandsoil.unl.edu/croptechnology20 05/gen/?what=animationList http://plantandsoil.unl.edu/croptechnology20 05/gen/?what=animationList C. Transforming Animal Cells-same as plants

14. The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

15. 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?

16. 13–4Applications of Genetic Engineering The universal nature of genetic mechanisms makes it possible to construct organisms that are transgenic, meaning that they contain genes from other species. A. Transgenic Organisms 1. Transgenic Microorganisms-insulin, HGH, Blood-clotting factor. 2. Transgenic Animals-grow faster and leaner 3.Transgenic Plants-make their own pesticides B. Cloning-may help save endangered species